dimercount - Count dimers in nucleotide sequence

Syntax

Dimers = dimercount(SeqNT)
[Dimers, Percent] = dimercount(SeqNT)

... = dimercount(SeqNT, 'Chart', ChartValue)

Arguments

SeqNT

One of the following:

Examples: 'ACGT' or [1 2 3 4]

ChartValueString specifying a chart type. Choices are 'pie' or 'bar'.

Return Values

DimersMATLAB structure containing the fields AA, AC, AG, AT, CA, CC, CG, CT, GA, GC, GG, GT, TA, TC, TG, and TT, which contain the dimer counts in SeqNT.
PercentA 4-by-4 matrix with the relative proportions of the dimers in SeqNT. The rows correspond to A, C, G, and T in the first element of the dimer, and the columns correspond to A, C, G, and T in the second element of the dimer.

Description

Dimers = dimercount(SeqNT) counts the nucleotide dimers in SeqNT, a nucleotide sequence, and returns the dimer counts in Dimers, a MATLAB structure containing the fields AA, AC, AG, AT, CA, CC, CG, CT, GA, GC, GG, GT, TA, TC, TG, and TT.

[Dimers, Percent] = dimercount(SeqNT) returns Percent, a 4-by-4 matrix with the relative proportions of the dimers in SeqNT. The rows correspond to A, C, G, and T in the first element of the dimer, and the columns correspond to A, C, G, and T in the second element of the dimer.


... = dimercount(SeqNT, 'Chart', ChartValue)
creates a chart showing the relative proportions of the dimers. ChartValue can be 'pie' or 'bar'.

Examples

Count the dimers in a nucleotide sequence and display a matrix of the percentage of each dimer.

[Dimers, Percent] = dimercount('TAGCTGGCCAAGCGAGCTTG')

Dimers = 

    AA: 1
    AC: 0
    AG: 3
    AT: 0
    CA: 1
    CC: 1
    CG: 1
    CT: 2
    GA: 1
    GC: 4
    GG: 1
    GT: 0
    TA: 1
    TC: 0
    TG: 2
    TT: 1


Percent =

    0.0526         0    0.1579         0
    0.0526    0.0526    0.0526    0.1053
    0.0526    0.2105    0.0526         0
    0.0526         0    0.1053    0.0526

See Also

Bioinformatics Toolbox™ functions: aacount, basecount, baselookup, codoncount, nmercount, ntdensity

  


 © 1984-2008- The MathWorks, Inc.    -   Site Help   -   Patents   -   Trademarks   -   Privacy Policy   -   Preventing Piracy   -   RSS