| Products & Services | Solutions | Academia | Support | User Community | Company |
| Download Product Updates | | | Get Pricing | | | Trial Software |
| Documentation → Bioinformatics Toolbox |
| Contents | Index |
| Learn more about Bioinformatics Toolbox |
Dimers = dimercount(SeqNT)
[Dimers, Percent]
= dimercount(SeqNT)
... = dimercount(SeqNT,
'Chart', ChartValue)
| SeqNT | One of the following:
Examples: 'ACGT' or [1 2 3 4] |
| ChartValue | String specifying a chart type. Choices are 'pie' or 'bar'. |
| Dimers | MATLAB structure containing the fields AA, AC, AG, AT, CA, CC, CG, CT, GA, GC, GG, GT, TA, TC, TG, and TT, which contain the dimer counts in SeqNT. |
| Percent | A 4-by-4 matrix with the relative proportions of the dimers in SeqNT. The rows correspond to A, C, G, and T in the first element of the dimer, and the columns correspond to A, C, G, and T in the second element of the dimer. |
Dimers = dimercount(SeqNT) counts the nucleotide dimers in SeqNT, a nucleotide sequence, and returns the dimer counts in Dimers, a MATLAB structure containing the fields AA, AC, AG, AT, CA, CC, CG, CT, GA, GC, GG, GT, TA, TC, TG, and TT.
For sequences that have dimers with the character U, these dimers are added to the corresponding dimers containing a T.
If the sequence contains ambiguous nucleotide characters (R, Y, K, M, S, W, B, D, H, V, or N), or gaps indicated by a hyphen (-), then these characters are counted in the field Others, and the following warning message appears.
Warning: Ambiguous symbols appear in the sequence. These will be in Others.
If the sequence contains undefined nucleotide characters (E, F, H, I, J, L, O, P, Q, X, or Z), then dimers containing these characters are counted in the field Others, and the following warning message appears:
Warning: Unknown symbols appear in the sequence. These will be in Others.
[Dimers, Percent] = dimercount(SeqNT) returns Percent, a 4-by-4 matrix with the relative proportions of the dimers in SeqNT. The rows correspond to A, C, G, and T in the first element of the dimer, and the columns correspond to A, C, G, and T in the second element of the dimer.
... = dimercount(SeqNT,
'Chart', ChartValue) creates
a chart showing the relative proportions of the dimers. ChartValue can
be 'pie' or 'bar'.
Count the dimers in a nucleotide sequence and display a matrix of the percentage of each dimer.
[Dimers, Percent] = dimercount('TAGCTGGCCAAGCGAGCTTG')
Dimers =
AA: 1
AC: 0
AG: 3
AT: 0
CA: 1
CC: 1
CG: 1
CT: 2
GA: 1
GC: 4
GG: 1
GT: 0
TA: 1
TC: 0
TG: 2
TT: 1
Percent =
0.0526 0 0.1579 0
0.0526 0.0526 0.0526 0.1053
0.0526 0.2105 0.0526 0
0.0526 0 0.1053 0.0526Bioinformatics Toolbox functions: aacount, basecount, baselookup, codoncount, nmercount, ntdensity
![]() | dayhoff | disp (DataMatrix) | ![]() |

Includes the most popular MATLAB recorded presentations with Q&A sessions led by MATLAB experts.
| © 1984-2009- The MathWorks, Inc. - Site Help - Patents - Trademarks - Privacy Policy - Preventing Piracy - RSS |