fastqwrite - Write to file using FASTQ format

Syntax

fastqwrite(File, FASTQStruct) fastqwrite(File, Header, Sequence, Qual)

Description

fastqwrite(File, FASTQStruct) writes the contents of a MATLAB structure or array of structures to a FASTQ-formatted file. If you specify an existing FASTQ-formatted file, fastqwrite appends the data to the file, instead of overwriting the file.

fastqwrite(File, Header, Sequence, Qual) writes header, sequence, and quality information to a FASTQ-formatted file.

Tip To append FASTQ-formatted data to an existing file, simply specify that file name. fastqwrite adds the data to the end of the file.

If you are using fastqwrite in a script, you can disable the append warning message by entering the following command lines before the fastqwrite command:

warnState = warning %Save the current warning state
warning('off','Bioinfo:fastqwrite:AppendToFile');

Then enter the following command line after the fastqwrite command:

warning(warnState) %Reset warning state to previous settings

Inputs

`File`	String specifying either a file name or a path and file name for saving the FASTQ-formatted data. If you specify only a file name, `fastqwrite` saves the file to the MATLAB Current Folder. If you specify an existing file, `fastqwrite` appends the data to the file, instead of overwriting the file.
`FASTQStruct`	MATLAB structure or array of structures containing the fields `Header`, `Sequence`, and `Quality`, such as returned by `fastqread`.
`Header`	String or name of a variable containing information about the nucleotide sequence. This text appears in the header of the FASTQ-formatted file, `File`.
`Sequence`	String or name of a variable containing a nucleotide sequence using the standard IUB/IUPAC letter or integer codes. For a list of valid characters, see Amino Acid Lookup or Nucleotide Lookup.
`Qual`	String or name of a variable containing ASCII representation of per-base quality scores for a nucleotide sequence.

Definitions

A FASTQ-formatted file contains nucleotide sequence and quality information on four lines:

Line 1 — Header information prefixed with an @ symbol
Line 2 — Nucleotide sequence
Line 3 — Header information prefixed with a + symbol
Line 4 — ASCII representation of per-base quality scores for the nucleotide sequence using Phred or Solexa encoding

Examples

Write multiple sequences to a FASTQ file from an array of structures:

% Read the contents of a FASTQ-formatted file into
% an array of structures
reads = fastqread('SRR005164_1_50.fastq');
% Create another array of structures for the first five reads
reads5 = reads(1:5);
% Write the first five reads to a separate FASTQ-formatted file
fastqwrite('fiveReads.fastq', reads5)

Write a single sequence to a FASTQ file from separate variables:

% Create separate variables for the header, sequence, and 
% quality information of a nucleotide sequence
h = 'MYSEQ-000_1_1_1_953_493';
s = 'GTTACCATGATGTTATTTCTTCATTTGGAGGTAAAA';
q = ']]]]]]]]]]]]]]]]]]]]]]T]]]]RJRZTQLOA';
% Write the information to a FASTQ-formatted file
fastqwrite('oneRead.fastq', h, s, q)

Tutorials

Working with Illumina/Solexa Next-Generation Sequencing Data

fastqwrite - Write to file using FASTQ format

Syntax

Description

Inputs

Definitions

Examples

See Also

Tutorials

How To

Related Links

Recommended Products