| Bioinformatics Toolbox™ | ![]() |
Look up Illumina® BeadStudio™ target (probe) sequence and annotation information
AnnotStruct =
ilmnbslookup(AnnotationFile, ID)
AnnotStruct =
ilmnbslookup(AnnotationFile, ID,
'LookUpField', LookUpFieldValue)
| AnnotationFile | An Illumina annotation file.
| |
| ID | Unique identifier for a target (probe) on an Illumina microarray.
| |
| LookUpFieldValue | Field in AnnotationFile where ilmnbslookup looks for the specified ID. Default is the Search_key field. |
| AnnotStruct | Structure containing the probe sequence and annotation information for a target (probe) specified by ID, and by AnnotationFile, an Illumina annotation file. |
AnnotStruct = ilmnbslookup(AnnotationFile, ID) returns AnnotStruct, a structure containing probe sequence and annotation information for a target (probe) specified by ID, and by AnnotationFile, an Illumina annotation file.
Tip You can download Illumina annotation files, such as HumanRef-8 v2 sequence.csv, from the Illumina Web site. From Support, access the downloads page, then see the section titled gene expression - probe sequences and annotation. |
Tip The ID identifier is returned in the TargetID field in the structure returned by the ilmnbsread function. |
AnnotStruct contains the same fields as the annotation file.
| Field | Description |
|---|---|
| Search_key | Unique identifier for the target |
| Target | Unique identifier for the target |
| ProbeId | Probe identifier |
| Gid | GenBank® ID for the gene associated with the target |
| Transcript | GenBank accession number for the transcript |
| Accession | GenBank accession number for the gene associated with the target |
| Symbol | Typically, the gene name |
| Type | Probe type |
| Start | Starting position of the probe sequence in the GenBank record |
| Probe_Sequence | Sequence of the probe |
| Definition | Definition field from the GenBank record |
| Ontology | Gene Ontology terms associated with the gene associated with the target |
| Synonym | Synonyms for the gene (taken from GenBank record) |
AnnotStruct = ilmnbslookup(AnnotationFile, ID, 'LookUpField', LookUpFieldValue) looks for ID in the annotation file in the field specified by LookUpFieldValue. Default is the Search_key field.
Read the contents of a tab-delimited file exported from the Illumina BeadStudio software into a MATLAB® structure. Note that the example file, GeneProfile.txt, is not provided with the Bioinformatics Toolbox™ software.
ilmnStruct = ilmnbsread('GeneProfile.txt')
ilmnStruct =
Header: 'Illumina BeadStudio data from GeneProfile.txt'
TargetID: {58428x1 cell}
ColumnNames: {1x29 cell}
Data: [58428x29 double]
TextColumnNames: {1x21 cell}
TextData: {58428x21 cell}Look up the probe sequence and annotation information for the 100th entry in the annotation file, HumanRef-8 v2 sequence.csv, by using the identifier for the 100th entry from the TargetID field of the structure created with the ilmnbsread function.
annotation = ilmnbslookup('HumanRef-8 v2 sequence.csv', ilmnStruct.TargetID{100})
annotation =
Search_key: 'ILMN_5259'
Target: 'ILMN_5259'
ProbeId: '0003460592'
Gid: '40316949'
Transcript: 'NM_032432.2'
Accession: 'NM_032432.2'
Symbol: 'ABLIM2'
Type: 'S'
Start: '3088'
Probe_Sequence: 'AAGTCTGTTTCCCCGTCCGCAGTGGGTGTTGCCTCTTTGTGTGTGTCCCG'
Definition: [1x71 char]
Ontology: [1x239 char]
Synonym: 'KIAA1808; DKFZp761F129'Bioinformatics Toolbox function: ilmnbsread
![]() | hmmprofstruct | ilmnbsread | ![]() |
| © 1984-2008- The MathWorks, Inc. - Site Help - Patents - Trademarks - Privacy Policy - Preventing Piracy - RSS |