ilmnbslookup

Look up Illumina® BeadStudio™ target (probe) sequence and annotation information

Syntax

AnnotStruct = ilmnbslookup(AnnotationFile, ID)
AnnotStruct = ilmnbslookup(AnnotationFile, ID, 'LookUpField', LookUpFieldValue)

Arguments

AnnotationFileAn Illumina annotation file.

    Tip   You can download Illumina annotation files, such as HumanRef-8 v2 sequence.csv, from the Illumina Web site. From Support, access the downloads page, then see the section titled gene expression - probe sequences and annotation.

IDUnique identifier for a target (probe) on an Illumina microarray.

    Tip   This identifier is returned in the TargetID field in the structure returned by the ilmnbsread function.

LookUpFieldValueField in AnnotationFile where ilmnbslookup looks for the specified ID. Default is the Search_key field.

Return Values

AnnotStructStructure containing the probe sequence and annotation information for a target (probe) specified by ID, and by AnnotationFile, an Illumina annotation file.

Description

AnnotStruct = ilmnbslookup(AnnotationFile, ID) returns AnnotStruct, a structure containing probe sequence and annotation information for a target (probe) specified by ID, and by AnnotationFile, an Illumina annotation file.

AnnotStruct contains the same fields as the annotation file.

FieldDescription
Search_keyUnique identifier for the target
TargetUnique identifier for the target
ProbeIdProbe identifier
GidGenBank® ID for the gene associated with the target
TranscriptGenBank accession number for the transcript
AccessionGenBank accession number for the gene associated with the target
SymbolTypically, the gene name
TypeProbe type
StartStarting position of the probe sequence in the GenBank record
Probe_SequenceSequence of the probe
DefinitionDefinition field from the GenBank record
OntologyGene Ontology terms associated with the gene associated with the target
SynonymSynonyms for the gene (taken from GenBank record)

AnnotStruct = ilmnbslookup(AnnotationFile, ID, 'LookUpField', LookUpFieldValue) looks for ID in the annotation file in the field specified by LookUpFieldValue. Default is the Search_key field.

Examples

  1. Read the contents of a tab-delimited file exported from the Illumina BeadStudio software into a MATLAB® structure. Note that the example file, GeneProfile.txt, is not provided with the Bioinformatics Toolbox™ software.

    ilmnStruct = ilmnbsread('GeneProfile.txt')
    
    ilmnStruct = 
    
                 Header: 'Illumina BeadStudio data from GeneProfile.txt'
               TargetID: {58428x1 cell}
            ColumnNames: {1x29 cell}
                   Data: [58428x29 double]
        TextColumnNames: {1x21 cell}
               TextData: {58428x21 cell}
  2. Look up the probe sequence and annotation information for the 100th entry in the annotation file, HumanRef-8 v2 sequence.csv, by using the identifier for the 100th entry from the TargetID field of the structure created with the ilmnbsread function.

    annotation = ilmnbslookup('HumanRef-8 v2 sequence.csv', ilmnStruct.TargetID{100})
    annotation = 
    
            Search_key: 'ILMN_5259'
                Target: 'ILMN_5259'
               ProbeId: '0003460592'
                   Gid: '40316949'
            Transcript: 'NM_032432.2'
             Accession: 'NM_032432.2'
                Symbol: 'ABLIM2'
                  Type: 'S'
                 Start: '3088'
        Probe_Sequence: 'AAGTCTGTTTCCCCGTCCGCAGTGGGTGTTGCCTCTTTGTGTGTGTCCCG'
            Definition: [1x71 char]
              Ontology: [1x239 char]
               Synonym: 'KIAA1808; DKFZp761F129'

See Also

Bioinformatics Toolbox function: ilmnbsread

  


 © 1984-2008- The MathWorks, Inc.    -   Site Help   -   Patents   -   Trademarks   -   Privacy Policy   -   Preventing Piracy   -   RSS