Bioinformatics Toolbox™

oligoprop - Calculate sequence properties of DNA oligonucleotide

Syntax

SeqProperties = oligoprop(SeqNT) SeqProperties = oligoprop(SeqNT, ...'Salt', SaltValue, ...) SeqProperties = oligoprop(SeqNT, ...'Temp', TempValue, ...) SeqProperties = oligoprop(SeqNT, ...'Primerconc', PrimerconcValue, ...) SeqProperties = oligoprop(SeqNT, ...'HPBase', HPBaseValue, ...) SeqProperties = oligoprop(SeqNT, ...'HPLoop', HPLoopValue, ...) SeqProperties = oligoprop(SeqNT, ...'Dimerlength', DimerlengthValue, ...)

Arguments

`SeqNT`	DNA oligonucleotide sequence represented by any of the following: Character string containing the letters `A`, `C`, `G`, `T`, or `N` Vector of integers containing the integers `1`, `2`, `3`, `4`, or `15` Structure containing a `Sequence` field that contains a nucleotide sequence
`SaltValue`	Value that specifies a salt concentration in moles/liter for melting temperature calculations. Default is `0.05` moles/liter.
`TempValue`	Value that specifies the temperature in degrees Celsius for nearest-neighbor calculations of free energy. Default is `25` degrees Celsius.
`PrimerconcValue`	Value that specifies the concentration in moles/liter for melting temperature calculations. Default is `50e-6` moles/liter.
`HPBaseValue`	Value that specifies the minimum number of paired bases that form the neck of the hairpin. Default is `4` base pairs.
`HPLoopValue`	Value that specifies the minimum number of bases that form the loop of a hairpin. Default is `2` bases.
`DimerlengthValue`	Value that specifies the minimum number of aligned bases between the sequence and its reverse. Default is `4` bases.

Return Values

SeqProperties Structure containing the sequence properties for a DNA oligonucleotide.

Description

SeqProperties = oligoprop(SeqNT) returns the sequence properties for a DNA oligonucleotide as a structure with the following fields:

Field	Description
`GC`	Percent GC content for the DNA oligonucleotide. Ambiguous `N` characters in `SeqNT` are considered to potentially be any nucleotide. If `SeqNT` contains ambiguous `N` characters, `GC` is the midpoint value, and its uncertainty is expressed by `GCdelta`.
`GCdelta`	The difference between `GC` (midpoint value) and either the maximum or minimum value `GC` could assume. The maximum and minimum values are calculated by assuming all `N` characters are G/C or not G/C, respectively. Therefore, `GCdelta` defines the possible range of GC content.
`Hairpins`	`H`-by-`length(SeqNT)` matrix of characters displaying all potential hairpin structures for the sequence `SeqNT`. Each row is a potential hairpin structure of the sequence, with the hairpin forming nucleotides designated by capital letters. `H` is the number of potential hairpin structures for the sequence. Ambiguous `N` characters in `SeqNT` are considered to potentially complement any nucleotide.
`Dimers`	`D`-by-`length(SeqNT)` matrix of characters displaying all potential dimers for the sequence `SeqNT`. Each row is a potential dimer of the sequence, with the self-dimerizing nucleotides designated by capital letters. `D` is the number of potential dimers for the sequence. Ambiguous `N` characters in `SeqNT` are considered to potentially complement any nucleotide.
`MolWeight`	Molecular weight of the DNA oligonucleotide. Ambiguous `N` characters in `SeqNT` are considered to potentially be any nucleotide. If `SeqNT` contains ambiguous `N` characters, `MolWeight` is the midpoint value, and its uncertainty is expressed by `MolWeightdelta`.
`MolWeightdelta`	The difference between `MolWeight` (midpoint value) and either the maximum or minimum value `MolWeight` could assume. The maximum and minimum values are calculated by assuming all `N` characters are `G` or `C`, respectively. Therefore, `MolWeightdelta` defines the possible range of molecular weight for `SeqNT`.
`Tm`	A vector with melting temperature values, in degrees Celsius, calculated by six different methods, listed in the following order: Basic (Marmur et al., 1962) Salt adjusted (Howley et al., 1979) Nearest-neighbor (Breslauer et al., 1986) Nearest-neighbor (SantaLucia Jr. et al., 1996) Nearest-neighbor (SantaLucia Jr., 1998) Nearest-neighbor (Sugimoto et al., 1996) Ambiguous `N` characters in `SeqNT` are considered to potentially be any nucleotide. If `SeqNT` contains ambiguous `N` characters, `Tm` is the midpoint value, and its uncertainty is expressed by `Tmdelta`.
`Tmdelta`	A vector containing the differences between `Tm` (midpoint value) and either the maximum or minimum value `Tm` could assume for each of the six methods. Therefore, `Tmdelta` defines the possible range of melting temperatures for `SeqNT`.
`Thermo`	`4`-by-`3` matrix of thermodynamic calculations. The rows correspond to nearest-neighbor parameters from: Breslauer et al., 1986 SantaLucia Jr. et al., 1996 SantaLucia Jr., 1998 Sugimoto et al., 1996 The columns correspond to: delta `H` — Enthalpy in kilocalories per mole, kcal/mol delta `S` — Entropy in calories per mole-degrees Kelvin, cal/(K)(mol) delta `G` — Free energy in kilocalories per mole, kcal/mol Ambiguous `N` characters in `SeqNT` are considered to potentially be any nucleotide. If `SeqNT` contains ambiguous `N` characters, `Thermo` is the midpoint value, and its uncertainty is expressed by `Thermodelta`.
`Thermodelta`	`4`-by-`3` matrix containing the differences between `Thermo` (midpoint value) and either the maximum or minimum value `Thermo` could assume for each calculation and method. Therefore, `Thermodelta` defines the possible range of thermodynamic values for `SeqNT`.

SeqProperties = oligoprop(SeqNT, ...'PropertyName', PropertyValue, ...) calls oligoprop with optional properties that use property name/property value pairs. You can specify one or more properties in any order. Each PropertyName must be enclosed in single quotation marks and is case insensitive. These property name/property value pairs are as follows:

SeqProperties = oligoprop(SeqNT, ...'Salt', SaltValue, ...) specifies a salt concentration in moles/liter for melting temperature calculations. Default is 0.05 moles/liter.

SeqProperties = oligoprop(SeqNT, ...'Temp', TempValue, ...) specifies the temperature in degrees Celsius for nearest-neighbor calculations of free energy. Default is 25 degrees Celsius.

SeqProperties = oligoprop(SeqNT, ...'Primerconc', PrimerconcValue, ...) specifies the concentration in moles/liter for melting temperatures. Default is 50e-6 moles/liter.

SeqProperties = oligoprop(SeqNT, ...'HPBase', HPBaseValue, ...) specifies the minimum number of paired bases that form the neck of the hairpin. Default is 4 base pairs.

SeqProperties = oligoprop(SeqNT, ...'HPLoop', HPLoopValue, ...) specifies the minimum number of bases that form the loop of a hairpin. Default is 2 bases.

SeqProperties = oligoprop(SeqNT, ...'Dimerlength', DimerlengthValue, ...) specifies the minimum number of aligned bases between the sequence and its reverse. Default is 4 bases.

Examples

Calculating Properties for a DNA Sequence

Create a random sequence.

seq = randseq(25)

seq =

TAGCTTCATCGTTGACTTCTACTAA

Calculate sequence properties of the sequence.

S1 = oligoprop(seq)

S1 = 

                GC: 36
           GCAlpha: 0
          Hairpins: [0x25 char]
            Dimers: 'tAGCTtcatcgttgacttctactaa'
         MolWeight: 7.5820e+003
    MolWeightAlpha: 0
                Tm: [52.7640 60.8629 62.2493 55.2870 54.0293 61.0614]
           TmAlpha: [0 0 0 0 0 0]
            Thermo: [4x3 double]
       ThermoAlpha: [4x3 double]

List the thermodynamic calculations for the sequence.

S1.Thermo

ans =

 -178.5000 -477.5700  -36.1125
 -182.1000 -497.8000  -33.6809
 -190.2000 -522.9000  -34.2974
 -191.9000 -516.9000  -37.7863

Calculating Properties for a DNA Sequence with Ambiguous Characters

Calculate sequence properties of the sequence ACGTAGAGGACGTN.

S2 = oligoprop('ACGTAGAGGACGTN')

S2 = 

                GC: 53.5714
           GCAlpha: 3.5714
          Hairpins: 'ACGTagaggACGTn'
            Dimers: [3x14 char]
         MolWeight: 4.3329e+003
    MolWeightAlpha: 20.0150
                Tm: [38.8357 42.2958 57.7880 52.4180 49.9633 55.1330]
           TmAlpha: [1.4643 1.4643 10.3885 3.4633 0.2829 3.8074]
            Thermo: [4x3 double]
       ThermoAlpha: [4x3 double]

List the potential dimers for the sequence.

S2.Dimers

ans =

ACGTagaggacgtn
ACGTagaggACGTn
acgtagagGACGTN

References

[1] Breslauer, K.J., Frank, R., Blöcker, H., and Marky, L.A. (1986). Predicting DNA duplex stability from the base sequence. Proceedings of the National Academy of Science USA 83, 3746–3750.

[2] Chen, S.H., Lin, C.Y., Cho, C.S., Lo, C.Z., and Hsiung, C.A. (2003). Primer Design Assistant (PDA): A web-based primer design tool. Nucleic Acids Research 31(13), 3751–3754.

[3] Howley, P.M., Israel, M.A., Law, M., and Martin, M.A. (1979). A rapid method for detecting and mapping homology between heterologous DNAs. Evaluation of polyomavirus genomes. The Journal of Biological Chemistry 254(11), 4876–4883.

[4] Marmur, J., and Doty, P. (1962). Determination of the base composition of deoxyribonucleic acid from its thermal denaturation temperature. Journal Molecular Biology 5, 109–118.

[5] Panjkovich, A., and Melo, F. (2005). Comparison of different melting temperature calculation methods for short DNA sequences. Bioinformatics 21(6), 711–722.

[6] SantaLucia Jr., J., Allawi, H.T., and Seneviratne, P.A. (1996). Improved Nearest-Neighbor Parameters for Predicting DNA Duplex Stability. Biochemistry 35, 3555–3562.

[7] SantaLucia Jr., J. (1998). A unified view of polymer, dumbbell, and oligonucleotide DNA nearest-neighbor thermodynamics. Proceedings of the National Academy of Science USA 95, 1460–1465.

[8] Sugimoto, N., Nakano, S., Yoneyama, M., and Honda, K. (1996). Improved thermodynamic parameters and helix initiation factor to predict stability of DNA duplexes. Nucleic Acids Research 24(22), 4501–4505.

[9] http://www.basic.northwestern.edu/biotools/oligocalc.html for weight calculations.