| Products & Services | Solutions | Academia | Support | User Community | Company |
| Download Product Updates | | | Get Pricing | | | Trial Software |
| Documentation → Bioinformatics Toolbox |
| Contents | Index |
| Learn more about Bioinformatics Toolbox |
SeqProperties = oligoprop(SeqNT)
SeqProperties = oligoprop(SeqNT,
...'Salt', SaltValue, ...)
SeqProperties = oligoprop(SeqNT,
...'Temp', TempValue, ...)
SeqProperties = oligoprop(SeqNT,
...'Primerconc', PrimerconcValue, ...)
SeqProperties = oligoprop(SeqNT,
...'HPBase', HPBaseValue, ...)
SeqProperties = oligoprop(SeqNT,
...'HPLoop', HPLoopValue, ...)
SeqProperties = oligoprop(SeqNT,
...'Dimerlength', DimerlengthValue, ...)
| SeqNT | DNA oligonucleotide sequence represented by any of the following:
|
| SaltValue | Value that specifies a salt concentration in moles/liter for melting temperature calculations. Default is 0.05 moles/liter. |
| TempValue | Value that specifies the temperature in degrees Celsius for nearest-neighbor calculations of free energy. Default is 25 degrees Celsius. |
| PrimerconcValue | Value that specifies the concentration in moles/liter for melting temperature calculations. Default is 50e-6 moles/liter. |
| HPBaseValue | Value that specifies the minimum number of paired bases that form the neck of the hairpin. Default is 4 base pairs. |
| HPLoopValue | Value that specifies the minimum number of bases that form the loop of a hairpin. Default is 2 bases. |
| DimerlengthValue | Value that specifies the minimum number of aligned bases between the sequence and its reverse. Default is 4 bases. |
| SeqProperties | Structure containing the sequence properties for a DNA oligonucleotide. |
SeqProperties = oligoprop(SeqNT) returns the sequence properties for a DNA oligonucleotide as a structure with the following fields:
| Field | Description |
|---|---|
| GC | Percent GC content for the DNA oligonucleotide. Ambiguous N characters in SeqNT are considered to potentially be any nucleotide. If SeqNT contains ambiguous N characters, GC is the midpoint value, and its uncertainty is expressed by GCdelta. |
| GCdelta | The difference between GC (midpoint value) and either the maximum or minimum value GC could assume. The maximum and minimum values are calculated by assuming all N characters are G/C or not G/C, respectively. Therefore, GCdelta defines the possible range of GC content. |
| Hairpins | H-by-length(SeqNT) matrix of characters displaying all potential hairpin structures for the sequence SeqNT. Each row is a potential hairpin structure of the sequence, with the hairpin forming nucleotides designated by capital letters. H is the number of potential hairpin structures for the sequence. Ambiguous N characters in SeqNT are considered to potentially complement any nucleotide. |
| Dimers | D-by-length(SeqNT) matrix of characters displaying all potential dimers for the sequence SeqNT. Each row is a potential dimer of the sequence, with the self-dimerizing nucleotides designated by capital letters. D is the number of potential dimers for the sequence. Ambiguous N characters in SeqNT are considered to potentially complement any nucleotide. |
| MolWeight | Molecular weight of the DNA oligonucleotide. Ambiguous N characters in SeqNT are considered to potentially be any nucleotide. If SeqNT contains ambiguous N characters, MolWeight is the midpoint value, and its uncertainty is expressed by MolWeightdelta. |
| MolWeightdelta | The difference between MolWeight (midpoint value) and either the maximum or minimum value MolWeight could assume. The maximum and minimum values are calculated by assuming all N characters are G or C, respectively. Therefore, MolWeightdelta defines the possible range of molecular weight for SeqNT. |
| Tm | A vector with melting temperature values, in degrees Celsius,
calculated by six different methods, listed in the following order:
Ambiguous N characters in SeqNT are considered to potentially be any nucleotide. If SeqNT contains ambiguous N characters, Tm is the midpoint value, and its uncertainty is expressed by Tmdelta. |
| Tmdelta | A vector containing the differences between Tm (midpoint value) and either the maximum or minimum value Tm could assume for each of the six methods. Therefore, Tmdelta defines the possible range of melting temperatures for SeqNT. |
| Thermo | 4-by-3 matrix of thermodynamic calculations. The rows correspond to nearest-neighbor parameters from: The columns correspond to:
Ambiguous N characters in SeqNT are considered to potentially be any nucleotide. If SeqNT contains ambiguous N characters, Thermo is the midpoint value, and its uncertainty is expressed by Thermodelta. |
| Thermodelta | 4-by-3 matrix containing the differences between Thermo (midpoint value) and either the maximum or minimum value Thermo could assume for each calculation and method. Therefore, Thermodelta defines the possible range of thermodynamic values for SeqNT. |
SeqProperties = oligoprop(SeqNT, ...'PropertyName', PropertyValue, ...) calls oligoprop with optional properties that use property name/property value pairs. You can specify one or more properties in any order. Each PropertyName must be enclosed in single quotation marks and is case insensitive. These property name/property value pairs are as follows:
SeqProperties = oligoprop(SeqNT,
...'Salt', SaltValue, ...) specifies
a salt concentration in moles/liter for melting temperature calculations.
Default is 0.05 moles/liter.
SeqProperties = oligoprop(SeqNT, ...'Temp', TempValue, ...) specifies the temperature in degrees Celsius for nearest-neighbor calculations of free energy. Default is 25 degrees Celsius.
SeqProperties = oligoprop(SeqNT, ...'Primerconc', PrimerconcValue, ...) specifies the concentration in moles/liter for melting temperatures. Default is 50e-6 moles/liter.
SeqProperties = oligoprop(SeqNT, ...'HPBase', HPBaseValue, ...) specifies the minimum number of paired bases that form the neck of the hairpin. Default is 4 base pairs.
SeqProperties = oligoprop(SeqNT, ...'HPLoop', HPLoopValue, ...) specifies the minimum number of bases that form the loop of a hairpin. Default is 2 bases.
SeqProperties = oligoprop(SeqNT, ...'Dimerlength', DimerlengthValue, ...) specifies the minimum number of aligned bases between the sequence and its reverse. Default is 4 bases.
Calculating Properties for a DNA Sequence
Create a random sequence.
seq = randseq(25) seq = TAGCTTCATCGTTGACTTCTACTAA
Calculate sequence properties of the sequence.
S1 = oligoprop(seq)
S1 =
GC: 36
GCAlpha: 0
Hairpins: [0x25 char]
Dimers: 'tAGCTtcatcgttgacttctactaa'
MolWeight: 7.5820e+003
MolWeightAlpha: 0
Tm: [52.7640 60.8629 62.2493 55.2870 54.0293 61.0614]
TmAlpha: [0 0 0 0 0 0]
Thermo: [4x3 double]
ThermoAlpha: [4x3 double]List the thermodynamic calculations for the sequence.
S1.Thermo ans = -178.5000 -477.5700 -36.1125 -182.1000 -497.8000 -33.6809 -190.2000 -522.9000 -34.2974 -191.9000 -516.9000 -37.7863
Calculating Properties for a DNA Sequence with Ambiguous Characters
Calculate sequence properties of the sequence ACGTAGAGGACGTN.
S2 = oligoprop('ACGTAGAGGACGTN')
S2 =
GC: 53.5714
GCAlpha: 3.5714
Hairpins: 'ACGTagaggACGTn'
Dimers: [3x14 char]
MolWeight: 4.3329e+003
MolWeightAlpha: 20.0150
Tm: [38.8357 42.2958 57.7880 52.4180 49.9633 55.1330]
TmAlpha: [1.4643 1.4643 10.3885 3.4633 0.2829 3.8074]
Thermo: [4x3 double]
ThermoAlpha: [4x3 double]List the potential dimers for the sequence.
S2.Dimers ans = ACGTagaggacgtn ACGTagaggACGTn acgtagagGACGTN
[1] Breslauer, K.J., Frank, R., Blöcker, H., and Marky, L.A. (1986). Predicting DNA duplex stability from the base sequence. Proceedings of the National Academy of Science USA 83, 3746–3750.
[2] Chen, S.H., Lin, C.Y., Cho, C.S., Lo, C.Z., and Hsiung, C.A. (2003). Primer Design Assistant (PDA): A web-based primer design tool. Nucleic Acids Research 31(13), 3751–3754.
[3] Howley, P.M., Israel, M.A., Law, M., and Martin, M.A. (1979). A rapid method for detecting and mapping homology between heterologous DNAs. Evaluation of polyomavirus genomes. The Journal of Biological Chemistry 254(11), 4876–4883.
[4] Marmur, J., and Doty, P. (1962). Determination of the base composition of deoxyribonucleic acid from its thermal denaturation temperature. Journal Molecular Biology 5, 109–118.
[5] Panjkovich, A., and Melo, F. (2005). Comparison of different melting temperature calculation methods for short DNA sequences. Bioinformatics 21(6), 711–722.
[6] SantaLucia Jr., J., Allawi, H.T., and Seneviratne, P.A. (1996). Improved Nearest-Neighbor Parameters for Predicting DNA Duplex Stability. Biochemistry 35, 3555–3562.
[7] SantaLucia Jr., J. (1998). A unified view of polymer, dumbbell, and oligonucleotide DNA nearest-neighbor thermodynamics. Proceedings of the National Academy of Science USA 95, 1460–1465.
[8] Sugimoto, N., Nakano, S., Yoneyama, M., and Honda, K. (1996). Improved thermodynamic parameters and helix initiation factor to predict stability of DNA duplexes. Nucleic Acids Research 24(22), 4501–4505.
[9] http://www.basic.northwestern.edu/biotools/oligocalc.html for weight calculations.
Bioinformatics Toolbox functions: isoelectric, molweight, ntdensity, palindromes, randseq
![]() | nwalign | optimalleaforder | ![]() |

Includes the most popular MATLAB recorded presentations with Q&A sessions led by MATLAB experts.
| © 1984-2009- The MathWorks, Inc. - Site Help - Patents - Trademarks - Privacy Policy - Preventing Piracy - RSS |