| Products & Services | Solutions | Academia | Support | User Community | Company |
| Download Product Updates | | | Get Pricing | | | Trial Software |
| Documentation → Bioinformatics Toolbox |
| Contents | Index |
| Learn more about Bioinformatics Toolbox |
[Position, Length]
= palindromes(SeqNT)
[Position, Length, Pal]
= palindromes(SeqNT)
... = palindromes(SeqNT,
..., 'Length', LengthValue, ...)
... = palindromes(SeqNT,
..., 'Complement', ComplementValue, ...)
| SeqNT | One of the following:
|
| LengthValue | Integer specifying a minimum length for palindromes. Default is 6. |
| ComplementValue | Controls the return of complementary palindromes, that is, where the elements match their complementary pairs A-T (or U) and C-G instead of an exact nucleotide match. Choices are true or false (default). |
[Position, Length] = palindromes(SeqNT) finds all palindromes in sequence SeqNT with a length greater than or equal to 6, and returns the starting indices, Position, and the lengths of the palindromes, Length.
[Position, Length, Pal] = palindromes(SeqNT) also returns a cell array, Pal, of the palindromes.
... = palindromes(SeqNT, ...'PropertyName', PropertyValue, ...) calls palindromes with optional properties that use property name/property value pairs. You can specify one or more properties in any order. Each PropertyName must be enclosed in single quotation marks and is case insensitive. These property name/property value pairs are as follows:
... = palindromes(SeqNT,
..., 'Length', LengthValue, ...) finds
all palindromes longer than or equal to LengthValue.
Default is 6.
... = palindromes(SeqNT, ..., 'Complement', ComplementValue, ...) controls the return of complementary palindromes, that is, where the elements match their complementary pairs A-T (or A-U) and C-G instead of an exact nucleotide match. Choices for ComplementValue are true or false (default).
Find the palindromes in a simple nucleotide sequence.
[p,l,s] = palindromes('GCTAGTAACGTATATATAAT')
p =
11
12
l =
7
7
s =
'TATATAT'
'ATATATA'
Find the complementary palindromes in a simple nucleotide sequence.
[pc,lc,sc] = palindromes('TAGCTTGTCACTGAGGCCA',...
'Complement',true)
pc =
8
lc =
7
sc =
'TCACTGA'Find the palindromes in a random nucleotide sequence.
a = randseq(100)
a =
TAGCTTCATCGTTGACTTCTACTAA
AAGCAAGCTCCTGAGTAGCTGGCCA
AGCGAGCTTGCTTGTGCCCGGCTGC
GGCGGTTGTATCCTGAATACGCCAT
[pos,len,pal]=palindromes(a)
pos =
74
len =
6
pal =
'GCGGCG'
Bioinformatics Toolbox functions: seqcomplement, seqrcomplement, seqreverse, seqshowwords
MATLAB functions: regexp, strfind
![]() | optimalleaforder | pam | ![]() |

Includes the most popular MATLAB recorded presentations with Q&A sessions led by MATLAB experts.
| © 1984-2009- The MathWorks, Inc. - Site Help - Patents - Trademarks - Privacy Policy - Preventing Piracy - RSS |