Bioinformatics Toolbox™

rebasecuts - Find restriction enzymes that cut nucleotide sequence

Syntax

[Enzymes, Sites] = rebasecuts(SeqNT)
rebasecuts(SeqNT, Group)
rebasecuts(SeqNT, [Q, R])
rebasecuts(SeqNT, S)

Arguments

Return Values

Description

[Enzymes, Sites] = rebasecuts(SeqNT) finds all the restriction enzymes that cut SeqNT, a nucleotide sequence.

rebasecuts(SeqNT, Group) limits the search to Group, a list of enzymes.

rebasecuts(SeqNT, [Q, R]) limits the search to those enzymes that cut after the base position specified by Q and before the base position specified by R.

rebasecuts(SeqNT, S) limits the search to those enzymes that cut just after the base position specified by S.

REBASE, the Restriction Enzyme Database, is a collection of information about restriction enzymes and related proteins. For more information about REBASE, see:

http://rebase.neb.com/rebase/rebase.html

Examples

1. Enter a nucleotide sequence.

   seq = 'AGAGGGGTACGCGCTCTGAAAAGCGGGAACCTCGTGGCGCTTTATTAA'

2. Look for all possible cleavage sites in the sequence seq.

    [enzymes sites] = rebasecuts(seq)

3. Find where restriction enzymes CfoI and Tru9I cut the sequence.

   [enzymes sites] = rebasecuts(seq, {'CfoI','Tru9I'})

4. Search for any possible enzymes that cut after base 7.

   enzymes  = rebasecuts(seq, 7)

5. Get the subset of enzymes that cut between base 11 and 37.

   enzymes  = rebasecuts(seq, [11 37])

See Also

Bioinformatics Toolbox™ functions: cleave, restrict, seq2regexp, seqshowwords

MATLAB^® function: regexp

rankfeatures

redbluecmap