restrict - Split nucleotide sequence at restriction site

Syntax

Fragments = restrict(SeqNT, Enzyme) Fragments = restrict(SeqNT, NTPattern, Position) [Fragments, CuttingSites] = restrict(...) [Fragments, CuttingSites, Lengths] = restrict(...) ... = restrict(..., 'PartialDigest', PartialDigestValue)

Arguments

SeqNT

One of the following:

String of codes specifying a nucleotide sequence. For valid letter codes, see the table Mapping Nucleotide Letter Codes to Integers.
Row vector of integers specifying a nucleotide sequence. For valid integers, see the table Mapping Nucleotide Integers to Letter Codes.
MATLAB structure containing a Sequence field that contains a nucleotide sequence, such as returned by fastaread, fastqread, emblread, getembl, genbankread, or getgenbank.

Enzyme

String specifying a name of a restriction enzyme from REBASE, the Restriction Enzyme Database.

Tip Some enzymes specify cutting rules for both a strand and its complement strand. restrict applies only the cutting rule for the 5' —> 3' strand. For a workaround to applying an enzyme cutting rule for both strands, see Splitting a Double-Stranded Nucleotide Sequence.

NTPattern

Short nucleotide sequence recognition pattern to search for in SeqNT, a larger sequence. NTPattern can be either of the following:

Character string
Regular expression

Position

Either of the following:

Integer specifying a position in the SeqNT to cut, relative to NTPattern.
Two-element vector specifying two positions in the SeqNT to cut, relative to NTPattern.

Note Position 0 corresponds to a cut before the first base of NTPattern.

PartialDigestValue

Value from 0 to 1 (default) specifying the probability that a cleavage site will be cut.

Description

Fragments = restrict(SeqNT, Enzyme) cuts SeqNT, a nucleotide sequence, into fragments at the restriction sites of Enzyme, a restriction enzyme. The restrict function stores the return values in Fragments, a cell array of sequences.

Fragments = restrict(SeqNT, NTPattern, Position) cuts SeqNT, a nucleotide sequence, into fragments at restriction sites specified by NTPattern, a nucleotide recognition pattern, and Position.

[Fragments, CuttingSites] = restrict(...) returns a numeric vector with the indices representing the cutting sites. The restrict function adds a 0 to the beginning of the CuttingSites vector so that the number of elements in CuttingSites equals the number of elements in Fragments. You can use CuttingSites + 1 to point to the first base of every fragment respective to the original sequence.

[Fragments, CuttingSites, Lengths] = restrict(...) returns a numeric vector with the lengths of every fragment.

... = restrict(..., 'PartialDigest', PartialDigestValue) simulates a partial digest where each restriction site in the sequence has a PartialDigestValue or probability of being cut.

REBASE, the Restriction Enzyme Database, is a collection of information about restriction enzymes and related proteins. For more information about REBASE or to search REBASE for the name of a restriction enzyme, see:

http://rebase.neb.com/rebase/rebase.html

Examples

Splitting a Nucleotide Sequence by Specifying an Enzyme

Enter a nucleotide sequence.

Seq = 'AGAGGGGTACGCGCTCTGAAAAGCGGGAACCTCGTGGCGCTTTATTAA';

Use the restriction enzyme HspAI (which specifies a recognition sequence of GCGC and a cleavage position of 1) to cleave the nucleotide sequence.
```
fragmentsEnzyme = restrict(Seq,'HspAI')

fragmentsEnzyme = 
    'AGAGGGGTACG'
    'CGCTCTGAAAAGCGGGAACCTCGTGG'
    'CGCTTTATTAA'
```

Splitting a Nucleotide Sequence by Specifying a Pattern and Position

Enter a nucleotide sequence.

Seq = 'AGAGGGGTACGCGCTCTGAAAAGCGGGAACCTCGTGGCGCTTTATTAA';

Use the sequence pattern GCGC with the point of cleavage at position 3 to cleave the nucleotide sequence.

fragmentsPattern = restrict(Seq,'GCGC',3)

fragmentsPattern = 
    'AGAGGGGTACGCG'
    'CTCTGAAAAGCGGGAACCTCGTGGCG'
    'CTTTATTAA'

Splitting a Nucleotide Sequence by Specifying a Regular Expression for the Pattern

Enter a nucleotide sequence.

Seq = 'AGAGGGGTACGCGCTCTGAAAAGCGGGAACCTCGTGGCGCTTTATTAA';

Use a regular expression to specify the sequence pattern.

fragmentsRegExp = restrict(Seq,'GCG[^C]',3)

fragmentsRegExp = 

    'AGAGGGGTACGCGCTCTGAAAAGCG'
    'GGAACCTCGTGGCGCTTTATTAA'

Returning the Cutting Sites and Fragment Lengths

Enter a nucleotide sequence.

Seq = 'AGAGGGGTACGCGCTCTGAAAAGCGGGAACCTCGTGGCGCTTTATTAA';

Capture the cutting sites and fragment lengths as well as the fragments.

[fragments, cut_sites, lengths] = restrict(Seq,'HspAI')

fragments = 
    'AGAGGGGTACG'
    'CGCTCTGAAAAGCGGGAACCTCGTGG'
    'CGCTTTATTAA'

cut_sites =
     0
    11
    37

lengths =
    11
    26
    11

Splitting a Double-Stranded Nucleotide Sequence

Some enzymes specify cutting rules for both a strand and its complement strand. restrict applies only the cutting rule for the 5' —> 3' strand. You can apply this rule manually for the complement strand.

Enter a nucleotide sequence.
```
seq = 'CCCGCNNNNNNN';
```
Use the seqcomplement function to determine the complement strand, which is in the 3' —> 5' direction.
```
seqc = seqcomplement(seq)
 
seqc =

GGGCGNNNNNNN
```
Cut the first strand using the restriction enzyme FauI (which specifies a recognition sequence pattern of CCCGC and a cleavage position of 9).
```
cuts_strand1 = restrict(seq, 'FauI')

cuts_strand1 = 

    'CCCGCNNNN'
    'NNN'
```
Cut the complement strand according the rule specified by FauI (which specifies a recognition sequence pattern of GGGCG with the point of cleavage at position 11).
```
cuts_strand2 = restrict(seqc, 'GGGCG', 11)

cuts_strand2 = 

    'GGGCGNNNNNN'
    'N'
```

References

[1] Roberts, R.J., Vincze, T., Posfai, J., and Macelis, D. (2007). REBASE—enzymes and genes for DNA restriction and modification. Nucl. Acids Res. 35, D269–D270.

[2] Official REBASE Web site: http://rebase.neb.com.

restrict - Split nucleotide sequence at restriction site

Syntax

Arguments

Description

Examples

References

See Also

Recommended Products