Bioinformatics Toolbox™

restrict - Split nucleotide sequence at restriction site

Syntax

Fragments = restrict(SeqNT, Enzyme)
Fragments = restrict(SeqNT, Pattern, Position)
[Fragments, CuttingSites] = restrict(...)
[Fragments, CuttingSites, Lengths] = restrict(...)

... = restrict(..., 'PartialDigest', PartialDigestValue)

Arguments

Description

Fragments = restrict(SeqNT, Enzyme) cuts SeqNT, a nucleotide sequence, into fragments at the restriction sites of Enzyme, a restriction enzyme. The return values are stored in Fragments, a cell array of sequences.

Fragments = restrict(SeqNT, Pattern, Position) cuts SeqNT, a nucleotide sequence into fragments at restriction sites specified by Pattern, a nucleotide pattern.

[Fragments, CuttingSites] = restrict(...) returns a numeric vector with the indices representing the cutting sites. A 0 (zero) is added to the list so numel(Fragments)==numel(CuttingSites). You can use CuttingSites+1 to point to the first base of every fragment respective to the original sequence.

[Fragments, CuttingSites, Lengths] = restrict(...) returns a numeric vector with the lengths of every fragment.

... = restrict(..., 'PartialDigest', PartialDigestValue) simulates a partial digest where each restriction site in the sequence has a PartialDigestValue or probability of being cut.

REBASE, the restriction enzyme database, is a collection of information about restriction enzymes and related proteins. For more information about REBASE or to search REBASE for the name of a restriction enzyme, see:

http://rebase.neb.com/rebase/rebase.html

Examples

1. Enter a nucleotide sequence.

   Seq = 'AGAGGGGTACGCGCTCTGAAAAGCGGGAACCTCGTGGCGCTTTATTAA';

2. Use the recognition pattern (sequence) GCGC with the point of cleavage at position 3 to cleave a nucleotide sequence.

   fragmentsPattern = restrict(Seq,'GCGC',3)
   
   fragmentsPattern = 
       'AGAGGGGTACGCG'
       'CTCTGAAAAGCGGGAACCTCGTGGCG'
       'CTTTATTAA'

3. Use the restriction enzyme HspAI (recognition sequence GCGC with the point of cleavage at position 1) to cleave a nucleotide sequence.

   fragmentsEnzyme = restrict(Seq,'HspAI')
   
   fragmentsEnzyme = 
       'AGAGGGGTACG'
       'CGCTCTGAAAAGCGGGAACCTCGTGG'
       'CGCTTTATTAA'

4. Use a regular expression for the enzyme pattern.

   fragmentsRegExp = restrict(Seq,'GCG[^C]',3)
   
   fragmentsRegExp = 
   
       'AGAGGGGTACGCGCTCTGAAAAGCG'
       'GGAACCTCGTGGCGCTTTATTAA'

5. Capture the cutting sites and fragment lengths with the fragments.

   [fragments, cut_sites, lengths] = restrict(Seq,'HspAI')
   
   fragments = 
       'AGAGGGGTACG'
       'CGCTCTGAAAAGCGGGAACCTCGTGG'
       'CGCTTTATTAA'
   
   cut_sites =
        0
       11
       37
   
   lengths =
       11
       26
       11

See Also

Bioinformatics Toolbox™ functions: cleave, rebasecuts, seq2regexp, seqshowwords

MATLAB^® function: regexp

redgreencmap

revgeneticcode