Bioinformatics Toolbox™

rnafold - Predict minimum free-energy secondary structure of RNA sequence

Syntax

rnafold(Seq) RNAbracket = rnafold(Seq) [RNAbracket, Energy] = rnafold(Seq) [RNAbracket, Energy, RNAmatrix] = rnafold(Seq) ... = rnafold(Seq, ...'MinLoopSize', MinLoopSizeValue, ...) ... = rnafold(Seq, ...'NoGU', NoGUValue, ...) ... = rnafold(Seq, ...'Progress', ProgressValue, ...)

Arguments

`Seq`	Either of the following: String specifying an RNA sequence. MATLAB^® structure containing a `Sequence` field that specifies an RNA sequence.
`MinLoopSizeValue`	Integer specifying the minimum size of the loops (in bases) to be considered when computing the free energy. Default is `3`.
`NoGUValue`	Controls whether GU or UG pairs are forbidden to form. Choices are `true` or `false` (default).
`ProgressValue`	Controls the display of a progress bar during the computation of the minimum free-energy secondary structure. Choices are `true` or `false` (default).

Return Values

`RNAbracket`	String of dots and brackets indicating the bracket notation for the minimum-free energy secondary structure of an RNA sequence. In the bracket notation, each dot represents an unpaired base, while a pair of equally nested, opening and closing brackets represents a base pair.
`Energy`	Value specifying the energy (in kcal/mol) of the minimum free-energy secondary structure of an RNA sequence.
`RNAmatrix`	Connectivity matrix representing the minimum free-energy secondary structure of an RNA sequence. A binary, upper-triangular matrix where `RNAmatrix(i, j) = 1` if and only if the `i`th residue in the RNA sequence `Seq` is paired with the `j`th residue of `Seq`.

Description

rnafold(Seq) predicts and displays the secondary structure (in bracket notation) associated with the minimum free energy for the RNA sequence, Seq, using the thermodynamic nearest-neighbor approach.

Note For long sequences, this prediction can be time consuming. For example, a 600-nucleotide sequence can take several minutes, and sequences greater than 1000 nucleotides can take over 1 hour, depending on your system.

RNAbracket = rnafold(Seq) predicts and returns the secondary structure associated with the minimum free energy for the RNA sequence, Seq, using the thermodynamic nearest-neighbor approach. The returned structure, RNAbracket, is in bracket notation, that is a vector of dots and brackets, where each dot represents an unpaired base, while a pair of equally nested, opening and closing brackets represents a base pair.

[RNAbracket, Energy] = rnafold(Seq) also returns Energy, the energy value (in kcal/mol) of the minimum free-energy secondary structure of the RNA sequence.

[RNAbracket, Energy, RNAmatrix] = rnafold(Seq) also returns RNAmatrix, a connectivity matrix representing the secondary structure associated with the minimum free energy. RNAmatrix is an upper triangular matrix where RNAmatrix(i, j) = 1 if and only if the ith residue in the RNA sequence Seq is paired with the jth residue of Seq.

... = rnafold(Seq, ...'PropertyName', PropertyValue, ...) calls rnafold with optional properties that use property name/property value pairs. You can specify one or more properties in any order. Each PropertyName must be enclosed in single quotation marks and is case insensitive. These property name/property value pairs are as follows:

... = rnafold(Seq, ...'MinLoopSize', MinLoopSizeValue, ...) specifies the minimum size of the loops (in bases) to be considered when computing the free energy. Default is 3.

... = rnafold(Seq, ...'NoGU', NoGUValue, ...) controls whether GU or UG pairs are forbidden to form. Choices are true or false (default).

... = rnafold(Seq, ...'Progress', ProgressValue, ...) controls the display of a progress bar during the computation of the minimum free-energy secondary structure. Choices are true or false (default).

Examples

Determine the minimum free-energy secondary structure (in both bracket and matrix notation) and the energy value of the following RNA sequence:

seq = 'ACCCCCUCCUUCCUUGGAUCAAGGGGCUCAA';
[bracket, energy, matrix] = rnafold(seq);
bracket

bracket =

..(((((...((....))...))))).....

References

[1] Wuchty, S., Fontana, W., Hofacker, I., and Schuster, P. (1999). Complete suboptimal folding of RNA and the stability of secondary structures. Biopolymers 49, 145–165.

[2] Matthews, D., Sabina, J., Zuker, M., and Turner, D. (1999). Expanded sequence dependence of thermodynamic parameters improves prediction of RNA secondary structure. J. Mol. Biol. 288, 911–940.