| Products & Services | Solutions | Academia | Support | User Community | Company |
| Download Product Updates | | | Get Pricing | | | Trial Software |
| Documentation → Bioinformatics Toolbox |
| Contents | Index |
| Learn more about Bioinformatics Toolbox |
rnafold(Seq)
RNAbracket = rnafold(Seq)
[RNAbracket, Energy] =
rnafold(Seq)
[RNAbracket, Energy, RNAmatrix]
= rnafold(Seq)
... = rnafold(Seq,
...'MinLoopSize', MinLoopSizeValue, ...)
... = rnafold(Seq,
...'NoGU', NoGUValue, ...)
... = rnafold(Seq,
...'Progress', ProgressValue, ...)
| Seq | Either of the following:
|
| MinLoopSizeValue | Integer specifying the minimum size of the loops (in bases) to be considered when computing the free energy. Default is 3. |
| NoGUValue | Controls whether GU or UG pairs are forbidden to form. Choices are true or false (default). |
| ProgressValue | Controls the display of a progress bar during the computation of the minimum free-energy secondary structure. Choices are true or false (default). |
| RNAbracket | String of dots and brackets indicating the bracket notation for the minimum-free energy secondary structure of an RNA sequence. In the bracket notation, each dot represents an unpaired base, while a pair of equally nested, opening and closing brackets represents a base pair. |
| Energy | Value specifying the energy (in kcal/mol) of the minimum free-energy secondary structure of an RNA sequence. |
| RNAmatrix | Connectivity matrix representing the minimum free-energy secondary structure of an RNA sequence. A binary, upper-triangular matrix where RNAmatrix(i, j) = 1 if and only if the ith residue in the RNA sequence Seq is paired with the jth residue of Seq. |
rnafold(Seq) predicts and displays the secondary structure (in bracket notation) associated with the minimum free energy for the RNA sequence, Seq, using the thermodynamic nearest-neighbor approach.
Note For long sequences, this prediction can be time consuming. For example, a 600-nucleotide sequence can take several minutes, and sequences greater than 1000 nucleotides can take over 1 hour, depending on your system. |
RNAbracket = rnafold(Seq) predicts and returns the secondary structure associated with the minimum free energy for the RNA sequence, Seq, using the thermodynamic nearest-neighbor approach. The returned structure, RNAbracket, is in bracket notation, that is a vector of dots and brackets, where each dot represents an unpaired base, while a pair of equally nested, opening and closing brackets represents a base pair.
[RNAbracket, Energy] = rnafold(Seq) also returns Energy, the energy value (in kcal/mol) of the minimum free-energy secondary structure of the RNA sequence.
[RNAbracket, Energy, RNAmatrix] = rnafold(Seq) also returns RNAmatrix, a connectivity matrix representing the secondary structure associated with the minimum free energy. RNAmatrix is an upper triangular matrix where RNAmatrix(i, j) = 1 if and only if the ith residue in the RNA sequence Seq is paired with the jth residue of Seq.
... = rnafold(Seq, ...'PropertyName', PropertyValue, ...) calls rnafold with optional properties that use property name/property value pairs. You can specify one or more properties in any order. Each PropertyName must be enclosed in single quotation marks and is case insensitive. These property name/property value pairs are as follows:
... = rnafold(Seq,
...'MinLoopSize', MinLoopSizeValue, ...) specifies
the minimum size of the loops (in bases) to be considered when computing
the free energy. Default is 3.
... = rnafold(Seq, ...'NoGU', NoGUValue, ...) controls whether GU or UG pairs are forbidden to form. Choices are true or false (default).
... = rnafold(Seq, ...'Progress', ProgressValue, ...) controls the display of a progress bar during the computation of the minimum free-energy secondary structure. Choices are true or false (default).
Determine the minimum free-energy secondary structure (in both bracket and matrix notation) and the energy value of the following RNA sequence:
seq = 'ACCCCCUCCUUCCUUGGAUCAAGGGGCUCAA'; [bracket, energy, matrix] = rnafold(seq);bracket bracket = ..(((((...((....))...))))).....
[1] Wuchty, S., Fontana, W., Hofacker, I., and Schuster, P. (1999). Complete suboptimal folding of RNA and the stability of secondary structures. Biopolymers 49, 145–165.
[2] Matthews, D., Sabina, J., Zuker, M., and Turner, D. (1999). Expanded sequence dependence of thermodynamic parameters improves prediction of RNA secondary structure. J. Mol. Biol. 288, 911–940.
Bioinformatics Toolbox functions: rnaconvert, rnaplot
![]() | rnaconvert | rnaplot | ![]() |

Includes the most popular MATLAB recorded presentations with Q&A sessions led by MATLAB experts.
| © 1984-2009- The MathWorks, Inc. - Site Help - Patents - Trademarks - Privacy Policy - Preventing Piracy - RSS |