Products & Services Solutions Academia Support User Community Company

Learn more about Bioinformatics Toolbox   

seqwordcount - Count number of occurrences of word in sequence

Syntax

seqwordcount(Seq, Word)

Arguments

Seq

Enter a nucleotide or amino acid sequence of characters. You can also enter a structure with the field Sequence.

Word

Enter a short sequence of characters.

Description

seqwordcount(Seq, Word) counts the number of times that a word appears in a sequence, and then returns the number of occurrences of that word.

If Word contains nucleotide or amino acid symbols that represent multiple possible symbols (ambiguous characters), then seqwordcount counts all matches. For example, the symbol R represents either G or A (purines). For another example, if word equals 'ART', then seqwordcount counts occurrences of both 'AAT' and 'AGT'.

Examples

seqwordcount does not count overlapping patterns multiple times. In the following example, seqwordcount reports three matches. TATATATA is counted as two distinct matches, not three overlapping occurrences.

seqwordcount('GCTATAACGTATATATAT','TATA')

ans =
     3

The following example reports two matches ('TAGT' and 'TAAT'). B is the ambiguous code for G, T, or C, while R is an ambiguous code for G and A.

seqwordcount('GCTAGTAACGTATATATAAT','BART')

ans =
     2

See Also

Bioinformatics Toolbox functions: codoncount, seqshoworfs, seqshowwords, seqtool, seq2regexp

MATLAB function: strfind

  


Recommended Products

Includes the most popular MATLAB recorded presentations with Q&A sessions led by MATLAB experts.

 © 1984-2009- The MathWorks, Inc.    -   Site Help   -   Patents   -   Trademarks   -   Privacy Policy   -   Preventing Piracy   -   RSS