Documentation

This is machine translation

Translated by Microsoft
Mouseover text to see original. Click the button below to return to the English verison of the page.

Note: This page has been translated by MathWorks. Please click here
To view all translated materals including this page, select Japan from the country navigator on the bottom of this page.

getInfo

Class: BioMap

Retrieve information for single element of BioMap object

Syntax

Info = getInfo(BioObj, Element)

Description

Info = getInfo(BioObj, Element) returns Info, a tab-delimited character vector containing information about a single element in BioObj, a BioMap object.

Input Arguments

BioObj

Object of the BioMap class.

Element

One of the following to specify one element in BioObj:

  • Scalar specifying an element index

  • Logical vector

  • Character vector containing a valid sequence header

Output Arguments

Info

Tab-delimited character vector containing information about a single element in BioObj, a BioMap object. The character vector contains the information from the following properties in order:

  • Header

  • Flag

  • Start

  • MappingQuality

  • Signature

  • Sequence

  • Quality

Examples

Construct a BioMap object, and then retrieve information for the second element in the object:

% Construct a BioMap object from a SAM file 
BMObj1 = BioMap('ex1.sam');
% Retrieve information for the second element in the object
element2Info = getInfo(BMObj1, 2)
element2Info =

EAS54_65:7:152:368:113	73	3	99	35M	
CTAGTGGCTCATTGTAAATGTGTGGTTTAACTCGT	
<<<<<<<<<<0<<<<655<<7<<<:9<<3/:<6):
Was this topic helpful?