Documentation

This is machine translation

Translated by Microsoft
Mouseover text to see original. Click the button below to return to the English verison of the page.

Note: This page has been translated by MathWorks. Please click here
To view all translated materals including this page, select Japan from the country navigator on the bottom of this page.

palindromes

Find palindromes in sequence

Syntax

[Position, Length] = palindromes(SeqNT)
[Position, Length, Pal] = palindromes(SeqNT)
... = palindromes(SeqNT, ..., 'Length', LengthValue, ...)
... = palindromes(SeqNT, ..., 'Complement', ComplementValue, ...)

Arguments

SeqNT

One of the following:

LengthValueInteger specifying a minimum length for palindromes. Default is 6.
ComplementValueControls the return of complementary palindromes, that is, where the elements match their complementary pairs A-T (or U) and C-G instead of an exact nucleotide match. Choices are true or false (default).

Description

[Position, Length] = palindromes(SeqNT) finds all palindromes in sequence SeqNT with a length greater than or equal to 6, and returns the starting indices, Position, and the lengths of the palindromes, Length.

[Position, Length, Pal] = palindromes(SeqNT) also returns a cell array, Pal, of the palindromes.

... = palindromes(SeqNT, ...'PropertyName', PropertyValue, ...) calls palindromes with optional properties that use property name/property value pairs. You can specify one or more properties in any order. Each PropertyName must be enclosed in single quotation marks and is case insensitive. These property name/property value pairs are as follows:

... = palindromes(SeqNT, ..., 'Length', LengthValue, ...) finds all palindromes longer than or equal to LengthValue. Default is 6.

... = palindromes(SeqNT, ..., 'Complement', ComplementValue, ...) controls the return of complementary palindromes, that is, where the elements match their complementary pairs A-T (or A-U) and C-G instead of an exact nucleotide match. Choices for ComplementValue are true or false (default).

Examples

Find the palindromes in a simple nucleotide sequence.

[p,l,s] = palindromes('GCTAGTAACGTATATATAAT')

p =
    11
    12
l =
     7
     7
s = 
    'TATATAT'
    'ATATATA'

Find the complementary palindromes in a simple nucleotide sequence.

[pc,lc,sc] = palindromes('TAGCTTGTCACTGAGGCCA',...
                         'Complement',true)
pc =
     8
lc =
     7
sc = 
    'TCACTGA'

Find the palindromes in a random nucleotide sequence.

a = randseq(100)

a =
TAGCTTCATCGTTGACTTCTACTAA
AAGCAAGCTCCTGAGTAGCTGGCCA
AGCGAGCTTGCTTGTGCCCGGCTGC
GGCGGTTGTATCCTGAATACGCCAT

[pos,len,pal]=palindromes(a)

pos =
    74
len =
     6
pal = 
    'GCGGCG' 

Introduced before R2006a

Was this topic helpful?