| Contents | Index |
fastqwrite(File, FASTQStruct)
fastqwrite(File, Header, Sequence, Qual)
fastqwrite(File, FASTQStruct) writes the contents of a MATLAB structure or array of structures to a FASTQ-formatted file. If you specify an existing FASTQ-formatted file, fastqwrite appends the data to the file, instead of overwriting the file.
fastqwrite(File, Header, Sequence, Qual) writes header, sequence, and quality information to a FASTQ-formatted file.
Tip To append FASTQ-formatted data to an existing file, simply specify that file name. fastqwrite adds the data to the end of the file. If you are using fastqwrite in a script, you can disable the append warning message by entering the following command lines before the fastqwrite command: warnState = warning %Save the current warning state
warning('off','Bioinfo:fastqwrite:AppendToFile'); Then enter the following command line after the fastqwrite command: warning(warnState) %Reset warning state to previous settings |
File |
String specifying either a file name or a path and file name for saving the FASTQ-formatted data. If you specify only a file name, fastqwrite saves the file to the MATLAB Current Folder. If you specify an existing file, fastqwrite appends the data to the file, instead of overwriting the file. |
FASTQStruct |
MATLAB structure or array of structures containing the fields Header, Sequence, and Quality, such as returned by fastqread. |
Header |
String or name of a variable containing information about the nucleotide sequence. This text appears in the header of the FASTQ-formatted file, File. |
Sequence |
String or name of a variable containing a nucleotide sequence using the standard IUB/IUPAC letter or integer codes. For a list of valid characters, see Amino Acid Lookup or Nucleotide Lookup. |
Qual |
String or name of a variable containing ASCII representation of per-base quality scores for a nucleotide sequence. |
A FASTQ-formatted file contains nucleotide sequence and quality information on four lines:
Line 1 — Header information prefixed with an @ symbol
Line 2 — Nucleotide sequence
Line 3 — Header information prefixed with a + symbol
Line 4 — ASCII representation of per-base quality scores for the nucleotide sequence using Phred or Solexa encoding
Write multiple sequences to a FASTQ file from an array of structures:
% Read the contents of a FASTQ-formatted file into
% an array of structures
reads = fastqread('SRR005164_1_50.fastq');
% Create another array of structures for the first five reads
reads5 = reads(1:5);
% Write the first five reads to a separate FASTQ-formatted file
fastqwrite('fiveReads.fastq', reads5)Write a single sequence to a FASTQ file from separate variables:
% Create separate variables for the header, sequence, and
% quality information of a nucleotide sequence
h = 'MYSEQ-000_1_1_1_953_493';
s = 'GTTACCATGATGTTATTTCTTCATTTGGAGGTAAAA';
q = ']]]]]]]]]]]]]]]]]]]]]]T]]]]RJRZTQLOA';
% Write the information to a FASTQ-formatted file
fastqwrite('oneRead.fastq', h, s, q)
BioRead | fastainfo | fastaread | fastawrite | fastqinfo | fastqread | saminfo | samread | sffinfo | sffread

See how to analyze, visualize, and model biological data and systems using MathWorks products.
Get free kit| © 1984-2012- The MathWorks, Inc. - Site Help - Patents - Trademarks - Privacy Policy - Preventing Piracy - RSS |