Skip to Main Content Skip to Search
Product Documentation

nt2int - Convert nucleotide sequence from letter to integer representation

Syntax

SeqInt = nt2int(SeqChar)

SeqInt = nt2int(SeqChar, ...'Unknown', UnknownValue, ...)
SeqInt = nt2int(SeqChar, ...'ACGTOnly', ACGTOnlyValue, ...)

Input Arguments

SeqChar

One of the following:

UnknownValueInteger to represent unknown nucleotides. Choices are integers ≥ 0 and ≤ 255. Default is 0.
ACGTOnlyValueControls the prohibition of ambiguous nucleotides. Choices are true or false (default). If ACGTOnlyValue is true, you can enter only the characters A, C, G, T, and U.

Output Arguments

SeqInt Nucleotide sequence specified by a row vector of integers.

Description

SeqInt = nt2int(SeqChar) converts SeqChar, a string of codes specifying a nucleotide sequence, to SeqInt, a row vector of integers specifying the same nucleotide sequence. For valid codes, see the table Mapping Nucleotide Letter Codes to Integers. Unknown characters (characters not in the table) are mapped to 0. Gaps represented with hyphens are mapped to 16.

SeqInt = nt2int(SeqChar, ...'PropertyName', PropertyValue, ...) calls nt2int with optional properties that use property name/property value pairs. You can specify one or more properties in any order. Each PropertyName must be enclosed in single quotation marks and is case insensitive. These property name/property value pairs are as follows:


SeqInt = nt2int(SeqChar, ...'Unknown', UnknownValue, ...)
specifies an integer to represent unknown nucleotides. UnknownValue can be an integer ≥ 0 and ≤ 255. Default is 0.

SeqInt = nt2int(SeqChar, ...'ACGTOnly', ACGTOnlyValue, ...) controls the prohibition of ambiguous nucleotides (N, R, Y, K, M, S, W, B, D, H, and V). Choices are true or false (default). If ACGTOnlyValue is true, you can enter only the characters A, C, G, T, and U.

Mapping Nucleotide Letter Codes to Integers

NucleotideCodeInteger
Adenosine A1
Cytidine C2
Guanine G3
Thymidine T4
Uridine (if 'Alphabet' set to 'RNA') U4
Purine (A or G) R5
Pyrimidine (T or C) Y6
Keto (G or T) K7
Amino (A or C) M8
Strong interaction (3 H bonds) (G or C) S9
Weak interaction (2 H bonds) (A or T) W10
Not A (C or G or T)B11
Not C (A or G or T)D12
Not G (A or C or T)H13
Not T or U (A or C or G)V14
Any nucleotide (A or C or G or T or U) N15
Gap of indeterminate length-16
Unknown (any character not in table)*0 (default)

Examples

Converting a Simple Sequence

Convert a nucleotide sequence from letters to integers.

s = nt2int('ACTGCTAGC') 

s = 
     1    2    4    3    2    4    1    3    2

Converting a Random Sequence

  1. Create a random character string to represent a nucleotide sequence.

    SeqChar = randseq(20)
    
    SeqChar =
    
    TTATGACGTTATTCTACTTT
  2. Convert the nucleotide sequence from letter to integer representation.

    SeqInt = nt2int(SeqChar)
    
    SeqInt =
    
      Columns 1 through 13
         4    4    1    4    3    1    2    3    4    4    1    4    4
    
      Columns 14 through 20 
         2    4    1    2    4    4    4
    

See Also

aa2int | baselookup | int2aa | int2nt

  


Free Computational Biology Interactive Kit

See how to analyze, visualize, and model biological data and systems using MathWorks products.

Get free kit

Trials Available

Try the latest computational biology products.

Get trial software
 © 1984-2012- The MathWorks, Inc.    -   Site Help   -   Patents   -   Trademarks   -   Privacy Policy   -   Preventing Piracy   -   RSS