Skip to Main Content Skip to Search
Product Documentation

rebasecuts - Find restriction enzymes that cut nucleotide sequence

Syntax

[Enzymes, Sites] = rebasecuts(SeqNT)
rebasecuts(SeqNT, Group)
rebasecuts(SeqNT, [Q, R])
rebasecuts(SeqNT, S)

Input Arguments

SeqNTNucleotide sequence.
GroupCell array of strings representing the names of valid restriction enzymes.
Q, RBase positions that limit the search to all sites between base Q and base R.
SBase position that limits the search to all sites after base S.

Output Arguments

EnzymesCell array with the names of restriction enzymes from REBASE®, the Restriction Enzyme Database.
SitesVector of cut sites identified with the base position number before every cut.

Description

[Enzymes, Sites] = rebasecuts(SeqNT) finds all the restriction enzymes that cut SeqNT, a nucleotide sequence.

rebasecuts(SeqNT, Group) limits the search to Group, a list of enzymes.

rebasecuts(SeqNT, [Q, R]) limits the search to those enzymes that cut after the base position specified by Q and before the base position specified by R.

rebasecuts(SeqNT, S) limits the search to those enzymes that cut just after the base position specified by S.

REBASE, the Restriction Enzyme Database, is a collection of information about restriction enzymes and related proteins. For more information about REBASE, see:

http://rebase.neb.com/rebase/rebase.html

Examples

  1. Create a nucleotide sequence.

    seq = 'AGAGGGGTACGCGCTCTGAAAAGCGGGAACCTCGTGGCGCTTTATTAA';
  2. Find all possible enzymes and cleavage sites in the sequence.

     [enzymes, sites] = rebasecuts(seq)
  3. Find where restriction enzymes CfoI and Tru9I cut the sequence.

    [enzymes, sites] = rebasecuts(seq, {'CfoI','Tru9I'})
    
    enzymes = 
    
        'CfoI'
        'CfoI'
        'Tru9I'
    
    sites =
    
        13
        39
        45
  4. Find all possible enzymes that cut after base 7.

    enzymes  = rebasecuts(seq, 7)
    
    enzymes = 
    
        'Csp6I'
        'CviQI'
        'RsaNI'
  5. Find all possible enzymes that cut between bases 11 and 37.

    enzymes  = rebasecuts(seq, [11 37])
    
    enzymes = 
    
        'AccII'
        'AspLEI'
        'BmiI'
        'Bsh1236I'
        'BspFNI'
        'BspLI'
        'BstFNI'
        'BstHHI'
        'BstUI'
        'CfoI'
        'FnuDII'
        'GlaI'
        'HhaI'
        'Hin6I'
        'HinP1I'
        'Hpy188I'
        'HspAI'
        'MvnI'
        'NlaIV'
        'PspN4I'
        'SetI'

References

[1] Roberts, R.J., Vincze, T., Posfai, J., and Macelis, D. (2007). REBASE—enzymes and genes for DNA restriction and modification. Nucl. Acids Res. 35, D269–D270.

[2] Official REBASE Web site: http://rebase.neb.com.

See Also

cleave | cleavelookup | regexp | restrict | seq2regexp | seqshowwords

  


Free Computational Biology Interactive Kit

See how to analyze, visualize, and model biological data and systems using MathWorks products.

Get free kit

Trials Available

Try the latest computational biology products.

Get trial software
 © 1984-2012- The MathWorks, Inc.    -   Site Help   -   Patents   -   Trademarks   -   Privacy Policy   -   Preventing Piracy   -   RSS