No BSD License  

Highlights from
gethgvbase

Be the first to rate this file! 5 Downloads (last 30 days) File Size: 5.57 KB File ID: #12280
image thumbnail

gethgvbase

by Colin Clarke

 

15 Sep 2006 (Updated 20 Sep 2006)

Extraction of single nucleotide polymorphism data from HGVBASE

| Watch this File

File Information
Description

%GETHGVBASE returns polymorphism data from the human genome variation db
% http://hgvbase.cgb.ki.se
%
%HGVDATA = gethgvbase(SNPID) reads in a %hgvbase web record from
%EMBL and creates a structure DATA %containing fields corresponding
%to the hgvBase keywords.
%
%FIELDNAME DESCRIPTIONS: a complete %description of field names can be
%found at: %http://hgvbase.cgb.ki.se/cgi-bin/main.pl?page=data_struct.htm
%
% Examples:
%
% data = gethgvbase('SNP000003319')
% hgvData = gethgvbase('SNP000003320')
%
% Reference:
%
%HGVbase: a human sequence variation %database emphasizing data
%quality and a broad spectrum of data %sources. Nucleic Acids Res. 2002 Jan
%1;30(1):387-91.
%
%See also:
%EMBLREAD, FASTAREAD, GENPEPTREAD, %GETGENBANK, SCFREAD, SEQTOOL.
%
%Colin Clarke, Cranfield University - %Analytical Science and Informatics
%$revision 1.0$ $Date: 12/09/2006$
%email: c.clarke.s03@cranfield.ac.uk

data = gethgvbase('SNP000003319')

data =

                 snpID: 'SNP000003319'
               varType: 'SNP'
             varStatus: 'Proven'
              geneType: 'Functional Gene'
            geneSymbol: 'COL4A4'
              geneName: 'collagen, type IV, alpha 4'
            geneRegion: 'I-Ex:CDS+'
    downStreamSequence: 'CCAGGACCAGGTATGAGCCGCATGC'
      upStreamSequence: 'TGGGGCTCCCTGGAATGAGAGGCCC'
               alleles: [2x1 char]
              sourceId: [2x12 char]
               DBXREFS: [3x21 char]
              citation: [2x41 char]
               feature: [14x12 char]
           motifChange: []
            population: 'European, African and Middle East (90 individuals)'
                  mesh: [25x31 char]

MATLAB release MATLAB 7.2 (R2006a)
Other requirements windows and linux compatible
Tags for This File  
Everyone's Tags
Tags I've Applied
Add New Tags Please login to tag files.
Please login to add a comment or rating.
Updates
18 Sep 2006

typos in submission and refinment of presentation

18 Sep 2006

typo

20 Sep 2006

typo layout

Tag Activity for this File
Tag Applied By Date/Time
biotech Colin Clarke 22 Oct 2008 08:39:33
pharmaceutical Colin Clarke 22 Oct 2008 08:39:33
bioinformatics Colin Clarke 22 Oct 2008 08:39:33
hgvbase Colin Clarke 22 Oct 2008 08:39:33
snp Colin Clarke 22 Oct 2008 08:39:33
polymorphism Colin Clarke 22 Oct 2008 08:39:33
human genome Colin Clarke 22 Oct 2008 08:39:33

Contact us at files@mathworks.com