Find restriction enzymes that cut nucleotide sequence
[Enzymes, Sites]
= rebasecuts(SeqNT)
rebasecuts(SeqNT, Group)
rebasecuts(SeqNT, [Q, R])
rebasecuts(SeqNT, S)
SeqNT | Nucleotide sequence. |
Group | Cell array of character vectors or string vector representing the names of valid restriction enzymes. |
Q, R | Base positions that limit the search to all sites between base Q and
base R. |
S | Base position that limits the search to all sites after base S. |
Enzymes | Cell array of character vectors containing the names of restriction enzymes from REBASE®, the Restriction Enzyme Database. |
Sites | Vector of cut sites identified with the base position number before every cut. |
[ finds all
the restriction enzymes that cut Enzymes, Sites]
= rebasecuts(SeqNT)SeqNT,
a nucleotide sequence.
rebasecuts( limits
the search to SeqNT, Group)Group, a list of enzymes.
rebasecuts( limits
the search to those enzymes that cut after the base position specified
by SeqNT, [Q, R])Q and before the base position specified
by R.
rebasecuts( limits
the search to those enzymes that cut just after the base position
specified by SeqNT, S)S.
REBASE, the Restriction Enzyme Database, is a collection of information about restriction enzymes and related proteins. For more information about REBASE, see:
Create a nucleotide sequence.
seq = 'AGAGGGGTACGCGCTCTGAAAAGCGGGAACCTCGTGGCGCTTTATTAA';Find all possible enzymes and cleavage sites in the sequence.
[enzymes, sites] = rebasecuts(seq)
Find where restriction enzymes CfoI and Tru9I cut
the sequence.
[enzymes, sites] = rebasecuts(seq, {'CfoI','Tru9I'})
enzymes =
'CfoI'
'CfoI'
'Tru9I'
sites =
13
39
45Find all possible enzymes that cut after base 7.
enzymes = rebasecuts(seq, 7)
enzymes =
'Csp6I'
'CviQI'
'RsaNI'Find all possible enzymes that cut between bases 11 and 37.
enzymes = rebasecuts(seq, [11 37])
enzymes =
'AccII'
'AspLEI'
'BmiI'
'Bsh1236I'
'BspFNI'
'BspLI'
'BstFNI'
'BstHHI'
'BstUI'
'CfoI'
'FnuDII'
'GlaI'
'HhaI'
'Hin6I'
'HinP1I'
'Hpy188I'
'HspAI'
'MvnI'
'NlaIV'
'PspN4I'
'SetI'[1] Roberts, R.J., Vincze, T., Posfai, J., and Macelis, D. (2007). REBASE—enzymes and genes for DNA restriction and modification. Nucl. Acids Res. 35, D269–D270.
[2] Official REBASE Web site: http://rebase.neb.com.
cleave | cleavelookup | regexp | restrict | seq2regexp