Predict minimum free-energy secondary structure of RNA sequence
rnafold(Seq)
RNAbracket = rnafold(Seq)
[RNAbracket, Energy] =
rnafold(Seq)
[RNAbracket, Energy, RNAmatrix]
= rnafold(Seq)
... = rnafold(Seq,
...'MinLoopSize', MinLoopSizeValue, ...)
... = rnafold(Seq,
...'NoGU', NoGUValue, ...)
... = rnafold(Seq,
...'Progress', ProgressValue, ...)
Seq | Either of the following:
|
MinLoopSizeValue | Integer specifying the minimum size of the loops (in bases)
to be considered when computing the free energy. Default is 3. |
NoGUValue | Controls whether GU or UG pairs are forbidden to form. Choices
are true or false (default). |
ProgressValue | Controls the display of a progress bar during the computation
of the minimum free-energy secondary structure. Choices are true or false (default). |
RNAbracket | Character vector of dots and brackets indicating the bracket notation for the minimum-free energy secondary structure of an RNA sequence. In the bracket notation, each dot represents an unpaired base, while a pair of equally nested, opening and closing brackets represents a base pair. |
Energy | Value specifying the energy (in kcal/mol) of the minimum free-energy secondary structure of an RNA sequence. |
RNAmatrix | Connectivity matrix representing the minimum free-energy secondary
structure of an RNA sequence. A binary, upper-triangular matrix where ith
residue in the RNA sequence Seq is paired
with the jth residue of Seq. |
rnafold( predicts
and displays the secondary structure (in bracket notation) associated
with the minimum free energy for the RNA sequence, Seq)Seq,
using the thermodynamic nearest-neighbor approach.
Note
For long sequences, this prediction can be time consuming. For example, a 600-nucleotide sequence can take several minutes, and sequences greater than 1000 nucleotides can take over 1 hour, depending on your system.
RNAbracket = rnafold(Seq)Seq, using
the thermodynamic nearest-neighbor approach. The returned structure, RNAbracket,
is in bracket notation, that is a vector of dots and brackets, where
each dot represents an unpaired base, while a pair of equally nested,
opening and closing brackets represents a base pair.
[ also returns RNAbracket, Energy] =
rnafold(Seq)Energy,
the energy value (in kcal/mol) of the minimum free-energy secondary
structure of the RNA sequence.
[ also returns RNAbracket, Energy, RNAmatrix]
= rnafold(Seq)RNAmatrix,
a connectivity matrix representing the secondary structure associated
with the minimum free energy. RNAmatrix is
an upper triangular matrix where RNAmatrix(i,
j) = 1ith
residue in the RNA sequence Seq is paired
with the jth residue of Seq.
... = rnafold( calls Seq, ...'PropertyName', PropertyValue,
...)rnafold with optional properties
that use property name/property value pairs. You can specify one or
more properties in any order. Each PropertyName must
be enclosed in single quotation marks and is case insensitive. These
property name/property value pairs are as follows:
specifies
the minimum size of the loops (in bases) to be considered when computing
the free energy. Default is ... = rnafold(Seq,
...'MinLoopSize', MinLoopSizeValue, ...)3.
... = rnafold(Seq,
...'NoGU', NoGUValue, ...)true or false (default).
... = rnafold(Seq,
...'Progress', ProgressValue, ...)true or false (default).
Determine the minimum free-energy secondary structure (in both bracket and matrix notation) and the energy value of the following RNA sequence:
seq = 'ACCCCCUCCUUCCUUGGAUCAAGGGGCUCAA';
[bracket, energy, matrix] = rnafold(seq);bracket
bracket =
..(((((...((....))...))))).....[1] Wuchty, S., Fontana, W., Hofacker, I., and Schuster, P. (1999). Complete suboptimal folding of RNA and the stability of secondary structures. Biopolymers 49, 145–165.
[2] Matthews, D., Sabina, J., Zuker, M., and Turner, D. (1999). Expanded sequence dependence of thermodynamic parameters improves prediction of RNA secondary structure. J. Mol. Biol. 288, 911–940.