Products & Services Solutions Academia Support User Community Company

Learn more about Bioinformatics Toolbox   

basecount - Count nucleotides in sequence

Syntax

NTStruct = basecount(SeqNT)

NTStruct = basecount(SeqNT, ...'Chart', ChartValue, ...)
NTStruct = basecount(SeqNT, ...'Others', OthersValue, ...)
NTStruct = basecount(SeqNT, ...'Structure', StructureValue, ...)

Arguments

SeqNT

One of the following:

ChartValueString specifying a chart type. Choices are 'pie' or 'bar'.
OthersValue

String specifying how to count ambiguous characters, including gaps indicated by a hyphen (-). Choices are 'full' (lists the ambiguous characters in separate fields) or 'bundle' (lists the ambiguous characters together in the field Others). Default is 'bundle'.

StructureValueSuppresses the unknown characters warning when set to 'full' .

Return Values

NTStruct1-by-1 MATLAB structure containing the fields A, C, G, and T.

Description

NTStruct = basecount(SeqNT) counts the number of each type of base in a SeqNT, a nucleotide sequence, and returns the counts in NTStruct, a 1-by-1 MATLAB structure containing the fields A, C, G, and T.

NTStruct = basecount(SeqNT, ...'PropertyName', PropertyValue, ...) calls basecount with optional properties that use property name/property value pairs. You can specify one or more properties in any order. Each PropertyName must be enclosed in single quotation marks and is case insensitive. These property name/property value pairs are as follows:


NTStruct = basecount(SeqNT, ...'Chart', ChartValue, ...)
creates a chart showing the relative proportions of the nucleotides. ChartValue can be 'pie' or 'bar'.

NTStruct = basecount(SeqNT, ...'Others', OthersValue, ...) specifies how to count ambiguous characters (R, Y, K, M, S, W, B, D, H, V, and N), or gaps indicated by a hyphen (-). Choices are 'full' (lists the ambiguous characters in separate fields) or 'bundle' (lists the ambiguous characters together in the field Others). Default is 'bundle'.

NTStruct = basecount(SeqNT, ...'Structure', StructureValue, ...) suppresses the unknown characters warning when set to 'full'.

Examples

  1. Count the bases in a DNA sequence and return the results in a structure.

    Bases = basecount('TAGCTGGCCAAGCGAGCTTG')
    
    Bases = 
    
        A: 4
        C: 5
        G: 7
        T: 4
    
  2. Get the count for adenosine (A) bases.

    Bases.A
    
    ans =
    
        4
    
  3. Count the bases in a DNA sequence containing ambiguous characters, listing the ambiguous characters in separate fields.

    basecount('ABCDGGCCAAGCGAGCTTG','Others','full')
    
    ans =
     
        A: 4
        C: 5
        G: 6
        T: 2
        R: 0
        Y: 0
        K: 0
        M: 0
        S: 0
        W: 0
        B: 1
        D: 1
        H: 0
        V: 0
        N: 0
      Gap: 0
    

See Also

Bioinformatics Toolbox functions: aacount, baselookup, codoncount, cpgisland, dimercount, nmercount, ntdensity, seqtool

  


Recommended Products

Includes the most popular MATLAB recorded presentations with Q&A sessions led by MATLAB experts.

 © 1984-2009- The MathWorks, Inc.    -   Site Help   -   Patents   -   Trademarks   -   Privacy Policy   -   Preventing Piracy   -   RSS