basecount - Count nucleotides in sequence

Syntax

Input Arguments

SeqNT	One of the following: String of codes specifying a nucleotide sequence. For valid letter codes, see the table Mapping Nucleotide Letter Codes to Integers Row vector of integers specifying a nucleotide sequence. For valid integers, see the table Mapping Nucleotide Integers to Letter Codes MATLAB structure containing a Sequence field that contains a nucleotide sequence, such as returned by fastaread, fastqread, emblread, getembl, genbankread, or getgenbank.
AmbiguousValue	String specifying how to treat ambiguous nucleotide characters (R, Y, K, M, S, W, B, D, H, V, or N). Choices are: 'ignore' (default) — Skips ambiguous characters 'bundle' — Counts ambiguous characters and reports the total count in the Ambiguous field. 'prorate' — Counts ambiguous characters and distributes them proportionately in the appropriate fields. For example, the counts for the character R are distributed evenly between the A and G fields. 'individual' — Counts ambiguous characters and reports them in individual fields. 'warn' — Skips ambiguous characters and displays a warning.
GapsValue	Specifies whether gaps, indicated by a hyphen (-), are counted or ignored. Choices are true or false (default).
ChartValue	String specifying a chart type. Choices are 'pie' or 'bar'.

Output Arguments

NTStruct

1-by-1 MATLAB structure containing the fields A, C, G, and T.

Description

NTStruct = basecount(SeqNT) counts the number of each type of base in SeqNT, a nucleotide sequence, and returns the counts in NTStruct, a 1-by-1 MATLAB structure containing the fields A, C, G, and T.

• The character U is added to the T field.

• Ambiguous nucleotide characters (R, Y, K, M, S, W, B, D, H, V, or N), and gaps, indicated by a hyphen (-), are ignored by default.

• Unrecognized characters are ignored and cause the following warning message.

  Warning: Unknown symbols appear in the sequence. These will be ignored.

NTStruct = basecount(SeqNT, ...'PropertyName', PropertyValue, ...) calls basecount with optional properties that use property name/property value pairs. You can specify one or more properties in any order. Each PropertyName must be enclosed in single quotation marks and is case insensitive. These property name/property value pairs are as follows:

NTStruct = basecount(SeqNT, ...'Ambiguous', AmbiguousValue, ...) specifies how to treat ambiguous nucleotide characters (R, Y, K, M, S, W, B, D, H, V, or N). Choices are:

• 'ignore' (default)

• 'bundle'

• 'prorate'

• 'individual'

• 'warn'

NTStruct = basecount(SeqNT, ...'Gaps', GapsValue, ...) specifies whether gaps, indicated by a hyphen (-), are counted or ignored. Choices are true or false (default).

NTStruct = basecount(SeqNT, ...'Chart', ChartValue, ...) creates a chart showing the relative proportions of the nucleotides. ChartValue can be 'pie' or 'bar'.

Examples

1. Count the bases in a DNA sequence and return the results in a structure.

   Bases = basecount('TAGCTGGCCAAGCGAGCTTG')
   
   Bases = 
   
       A: 4
       C: 5
       G: 7
       T: 4
   

2. Get the count for adenosine (A) bases.

   Bases.A
   
   ans =
   
       4
   

3. Count the bases in a DNA sequence containing ambiguous characters, listing the ambiguous characters in separate fields.

   basecount('ABCDGGCCAAGCGAGCTTG','Ambiguous','individual')
   
   ans =
    
       A: 4
       C: 5
       G: 6
       T: 2
       R: 0
       Y: 0
       K: 0
       M: 0
       S: 0
       W: 0
       B: 1
       D: 1
       H: 0
       V: 0
       N: 0
   

See Also

aacount | baselookup | codoncount | cpgisland | dimercount | nmercount | ntdensity | seqtool

© 1984-2012- The MathWorks, Inc.    -   Site Help   -   Patents   -   Trademarks   -   Privacy Policy   -   Preventing Piracy   -   RSS