dimercount - Count dimers in nucleotide sequence

Syntax

Input Arguments

SeqNT	One of the following: String of codes specifying a nucleotide sequence. For valid letter codes, see the table Mapping Nucleotide Letter Codes to Integers. Row vector of integers specifying a nucleotide sequence. For valid integers, see the table Mapping Nucleotide Integers to Letter Codes. MATLAB structure containing a Sequence field that contains a nucleotide sequence, such as returned by fastaread, fastqread, emblread, getembl, genbankread, or getgenbank. Examples: 'ACGT' or [1 2 3 4]
AmbiguousValue	String specifying how to treat dimers containing ambiguous nucleotide characters (R, Y, K, M, S, W, B, D, H, V, or N). Choices are: 'ignore' (default) — Skips dimers containing ambiguous characters 'bundle' — Counts dimers containing ambiguous characters and reports the total count in the Ambiguous field of the Dimers output structure. 'prorate' — Counts dimers containing ambiguous characters and distributes them proportionately in the appropriate dimer fields containing standard nucleotide characters. For example, the counts for the dimer AR are distributed evenly between the AA and AG fields. 'warn' — Skips dimers containing ambiguous characters and displays a warning.
ChartValue	String specifying a chart type. Choices are 'pie' or 'bar'.

Output Arguments

Dimers	MATLAB structure containing the fields AA, AC, AG, AT, CA, CC, CG, CT, GA, GC, GG, GT, TA, TC, TG, and TT, which contain the dimer counts in SeqNT.
Percent	A 4-by-4 matrix with the relative proportions of the dimers in SeqNT. The rows correspond to A, C, G, and T in the first element of the dimer, and the columns correspond to A, C, G, and T in the second element of the dimer.

Description

Dimers = dimercount(SeqNT) counts the nucleotide dimers in SeqNT, a nucleotide sequence, and returns the dimer counts in Dimers, a MATLAB structure containing the fields AA, AC, AG, AT, CA, CC, CG, CT, GA, GC, GG, GT, TA, TC, TG, and TT.

• For sequences that have dimers with the character U, these dimers are added to the corresponding dimers containing a T.

• If the sequence contains gaps indicated by a hyphen (-), the gaps are ignored, and the two characters on either side of the gap are counted as a dimer.

• If the sequence contains unrecognized characters, then dimers containing these characters are ignored, and the following warning message appears:

  Warning: Unknown symbols appear in the sequence. These will be ignored.

[Dimers, Percent] = dimercount(SeqNT) returns Percent, a 4-by-4 matrix with the relative proportions of the dimers in SeqNT. The rows correspond to A, C, G, and T in the first element of the dimer, and the columns correspond to A, C, G, and T in the second element of the dimer.

... = dimercount(SeqNT, 'Ambiguous', AmbiguousValue) specifies how to treat dimers containing ambiguous nucleotide characters. Choices are:

• 'ignore' (default)

• 'bundle'

• 'prorate'

• 'warn'

... = dimercount(SeqNT, 'Chart', ChartValue) creates a chart showing the relative proportions of the dimers. ChartValue can be 'pie' or 'bar'.

Examples

Count the dimers in a nucleotide sequence and display a matrix of the percentage of each dimer.

[Dimers, Percent] = dimercount('TAGCTGGCCAAGCGAGCTTG')

Dimers = 

    AA: 1
    AC: 0
    AG: 3
    AT: 0
    CA: 1
    CC: 1
    CG: 1
    CT: 2
    GA: 1
    GC: 4
    GG: 1
    GT: 0
    TA: 1
    TC: 0
    TG: 2
    TT: 1


Percent =

    0.0526         0    0.1579         0
    0.0526    0.0526    0.0526    0.1053
    0.0526    0.2105    0.0526         0
    0.0526         0    0.1053    0.0526

See Also

aacount | basecount | baselookup | codoncount | nmercount | ntdensity

© 1984-2012- The MathWorks, Inc.    -   Site Help   -   Patents   -   Trademarks   -   Privacy Policy   -   Preventing Piracy   -   RSS