understanding the bioinformatic tool
Show older comments
Dear Matlab Team, I am really enjoying Matlab and your internet help. I am corrently working with http://www.mathworks.com/help/pdf_doc/bioinfo/bioinfo_ug.pdf
In page 2-77 I used two lines I am not sure about: fow_idx = find(~bitget(getFlag(bm1_filtered),5)); rev_idx = find(bitget(getFlag(bm1_filtered),5));
it says there: "get the indices for the forward and the reverse reads in each pair. This information is captured in the fifth bit of the flag field"
in the end of this page an example is shown (and I got the same): SRR054715.sra.6849385 163 20 60 40M AACCCTAAACCTCTGAATCCTTAATCCCTAAATCCCTAA SRR054715.sra.6849385 83 229 60 40M CCTATTTCTTGTGGTTTTCTTTCCTTCACTTAGCTATGG SRR054715.sra.6992346 99 20 60 40M AACCCTAAACCTCTGAATCCTTAATCCCTAAATCCCTAAA SRR054715.sra.6992346 147 239 60 40M GTGGTTTTCTTTCCTTCACTTAGCTATGGATGGTTTAT
when looking at the flags: the forward index include: 163 and 99 and the reverse: 83 and 147.
using: http://picard.sourceforge.net/explain-flags.html If I understand correctly the forward should include: 99 and 83 that are the firsts in the pair and not 163?
I think that the correct bit for the forward should be 7 or 8 and not 5?
Maybe I don't understand something, I will thank you to correct my way of thinking. Best, yishai
Accepted Answer
More Answers (0)
Categories
Find more on Genomics and Next Generation Sequencing in Help Center and File Exchange
Community Treasure Hunt
Find the treasures in MATLAB Central and discover how the community can help you!
Start Hunting!