DNA fragments are made by DNA sequencer.
To find full sequence, we need to concatenate each other using common sequence information.
So, when Input sequences are
(1) ATCGATCGAAGTCATCGGGAAA
(3) GGAAAGATCGATTACTTCCGAAA
(2) CCGAAAACCTAAGGGTTCTCAATGAC .
Output sequence is
'ATCGATCGAAGTCATCGGGAAAGATCGATTACTTCCGAAAACCTAAGGGTTCTCAATGAC' .
Solution Stats
Solution Comments
Show comments
Loading...
Problem Recent Solvers4
Suggested Problems
-
Number of 1s in the Binary Representation of a Number
487 Solvers
-
174 Solvers
-
Rotate and display numbered tile
386 Solvers
-
middleAsColumn: Return all but first and last element as a column vector
653 Solvers
-
388 Solvers
More from this Author2
Problem Tags
Community Treasure Hunt
Find the treasures in MATLAB Central and discover how the community can help you!
Start Hunting!