DNA fragments are made by DNA sequencer.
To find full sequence, we need to concatenate each other using common sequence information.
So, when Input sequences are
(1) ATCGATCGAAGTCATCGGGAAA
(3) GGAAAGATCGATTACTTCCGAAA
(2) CCGAAAACCTAAGGGTTCTCAATGAC .
Output sequence is
'ATCGATCGAAGTCATCGGGAAAGATCGATTACTTCCGAAAACCTAAGGGTTCTCAATGAC' .
Solve

Solution Stats

16 Solutions

3 Solvers

Last Solution submitted on Oct 02, 2025

Last 200 Solutions

Solution Comments

Show comments

Problem Recent Solvers3

Tim William Soobok

Suggested Problems

More from this Author2

Problem Tags

Community Treasure Hunt

Find the treasures in MATLAB Central and discover how the community can help you!

Start Hunting!