| Bioinformatics Toolbox™ | |
Seq = randseq(SeqLength)
Seq = randseq(SeqLength,
...'Alphabet', AlphabetValue, ...)
Seq = randseq(SeqLength,
...'Weights', WeightsValue, ...)
Seq = randseq(SeqLength,
...'FromStructure', FromStructureValue, ...)
Seq = randseq(SeqLength,
...'Case', CaseValue, ...)
Seq = randseq(SeqLength,
...'DataType', DataTypeValue, ...)
| SeqLength | Number of amino acids or nucleotides in random sequence . |
| AlphabetValue | Property to select the alphabet for the sequence. Enter 'dna'(default), 'rna', or 'amino'. |
| WeightsValue | Property to specify a weighted random sequence. |
| FromStructureValue | Property to specify a weighted random sequence using output structures from the functions from basecount, dimercount, codoncount, or aacount. |
| CaseValue | Property to select the case of letters in a sequence whenAlphabet is 'char'. Values are'upper' (default) or 'lower'. |
| DataTypeValue | Property to select the data type for a sequence. Values are 'char'(default) for letter sequences, and 'uint8' or 'double' for numeric sequences. Creates a sequence as an array of DataType. |
Seq = randseq(SeqLength) creates a random sequence with a length specified by SeqLength.
Seq = randseq(SeqLength, ...'PropertyName', PropertyValue, ...) calls randseq with optional properties that use property name/property value pairs. You can specify one or more properties in any order. Each PropertyName must be enclosed in single quotes and is case insensitive. These property name/property value pairs are as follows:
Seq = randseq(SeqLength,
...'Alphabet', AlphabetValue, ...) generates
a sequence from a specific alphabet.
Seq = randseq(SeqLength, ...'Weights', WeightsValue, ...) creates a weighted random sequence where the ith letter of the sequence alphabet is selected with weight W(i). The weight vector is usually a probability vector or a frequency count vector. Note that the ith element of the nucleotide alphabet is given by int2nt(i), and the ith element of the amino acid alphabet is given by int2aa(i).
Seq = randseq(SeqLength, ...'FromStructure', FromStructureValue, ...) creates a weighted random sequence with weights given by the output structure from basecount, dimercount, codoncount, or aacount.
Seq = randseq(SeqLength, ...'Case', CaseValue, ...) specifies the case for a letter sequence.
Seq = randseq(SeqLength, ...'DataType', DataTypeValue, ...) specifies the data type for the sequence array.
Generate a random DNA sequence.
randseq(20) ans = TAGCTGGCCAAGCGAGCTTG
Generate a random RNA sequence.
randseq(20,'alphabet','rna') ans = GCUGCGGCGGUUGUAUCCUG
Generate a random protein sequence.
randseq(20,'alphabet','amino') ans = DYKMCLYEFGMFGHFTGHKK
Statistics Toolbox™ functions: hmmgenerate, randsample
MATLAB® functions: rand, randperm
| randfeatures | rankfeatures | |
| © 1984-2008- The MathWorks, Inc. - Site Help - Patents - Trademarks - Privacy Policy - Preventing Piracy - RSS |