Skip to Main Content Skip to Search
Product Documentation

randseq - Generate random sequence from finite alphabet

Syntax

Seq = randseq(SeqLength)

Seq = randseq(SeqLength, ...'Alphabet', AlphabetValue,...)
Seq = randseq(SeqLength, ...'Weights', WeightsValue,...)
Seq = randseq(SeqLength, ...'FromStructure',FromStructureValue, ...)
Seq = randseq(SeqLength, ...'Case', CaseValue, ...)
Seq = randseq(SeqLength, ...'DataType', DataTypeValue, ...)

Arguments

SeqLengthInteger that specifies the number of nucleotides or amino acids in the random sequence .
AlphabetValue

String that specifies the alphabet for the sequence. Choices are 'dna'(default), 'rna', or 'amino'.

WeightsValue

Property to specify a weighted random sequence.

FromStructureValue

Property to specify a weighted random sequence using output structures from the functions from basecount, dimercount, codoncount, or aacount.

CaseValue

String that specifies the case of letters in a sequence when Alphabet is 'char'. Choices are'upper' (default) or 'lower'.

DataTypeValue

String that specifies the data type for a sequence. Choices are 'char'(default) for letter sequences, and 'uint8' or 'double' for numeric sequences.

Creates a sequence as an array of DataType.

Description

Seq = randseq(SeqLength) creates a random sequence with a length specified by SeqLength.

Seq = randseq(SeqLength, ...'PropertyName', PropertyValue, ...) calls randseq with optional properties that use property name/property value pairs. You can specify one or more properties in any order. Each PropertyName must be enclosed in single quotation marks and is case insensitive. These property name/property value pairs are as follows:


Seq = randseq(SeqLength, ...'Alphabet', AlphabetValue, ...)
generates a sequence from a specific alphabet.

Seq = randseq(SeqLength, ...'Weights', WeightsValue, ...) creates a weighted random sequence where the ith letter of the sequence alphabet is selected with weight W(i). The weight vector is usually a probability vector or a frequency count vector. Note that the ith element of the nucleotide alphabet is given by int2nt(i), and the ith element of the amino acid alphabet is given by int2aa(i).

Seq = randseq(SeqLength, ...'FromStructure', FromStructureValue, ...) creates a weighted random sequence with weights given by the output structure from basecount, dimercount, codoncount, or aacount.

Seq = randseq(SeqLength, ...'Case', CaseValue, ...) specifies the case for a letter sequence.

Seq = randseq(SeqLength, ...'DataType', DataTypeValue, ...) specifies the data type for the sequence array.

Examples

Generate a random DNA sequence.

randseq(20)

ans =
TAGCTGGCCAAGCGAGCTTG

Generate a random RNA sequence.

randseq(20,'alphabet','rna')

ans = 
GCUGCGGCGGUUGUAUCCUG

Generate a random protein sequence.

randseq(20,'alphabet','amino')

ans =
DYKMCLYEFGMFGHFTGHKK

See Also

hmmgenerate | rand | randperm | randsample

  


Free Computational Biology Interactive Kit

See how to analyze, visualize, and model biological data and systems using MathWorks products.

Get free kit

Trials Available

Try the latest computational biology products.

Get trial software
 © 1984-2012- The MathWorks, Inc.    -   Site Help   -   Patents   -   Trademarks   -   Privacy Policy   -   Preventing Piracy   -   RSS