| Contents | Index |
Fragments = restrict(SeqNT, Enzyme)
Fragments = restrict(SeqNT, NTPattern, Position)
[Fragments, CuttingSites]
= restrict(...)
[Fragments, CuttingSites, Lengths]
= restrict(...)
... = restrict(..., 'PartialDigest', PartialDigestValue)
| SeqNT | One of the following:
| |
| Enzyme | String specifying a name of a restriction enzyme from REBASE, the Restriction Enzyme Database.
| |
| NTPattern | Short nucleotide sequence recognition pattern to search for in SeqNT, a larger sequence. NTPattern can be either of the following:
| |
| Position | Either of the following:
| |
| PartialDigestValue | Value from 0 to 1 (default) specifying the probability that a cleavage site will be cut. |
Fragments = restrict(SeqNT, Enzyme) cuts SeqNT, a nucleotide sequence, into fragments at the restriction sites of Enzyme, a restriction enzyme. The restrict function stores the return values in Fragments, a cell array of sequences.
Fragments = restrict(SeqNT, NTPattern, Position) cuts SeqNT, a nucleotide sequence, into fragments at restriction sites specified by NTPattern, a nucleotide recognition pattern, and Position.
[Fragments, CuttingSites] = restrict(...) returns a numeric vector with the indices representing the cutting sites. The restrict function adds a 0 to the beginning of the CuttingSites vector so that the number of elements in CuttingSites equals the number of elements in Fragments. You can use CuttingSites + 1 to point to the first base of every fragment respective to the original sequence.
[Fragments, CuttingSites, Lengths] = restrict(...) returns a numeric vector with the lengths of every fragment.
... = restrict(..., 'PartialDigest', PartialDigestValue) simulates
a partial digest where each restriction site in the sequence has a PartialDigestValue or
probability of being cut.
REBASE, the Restriction Enzyme Database, is a collection of information about restriction enzymes and related proteins. For more information about REBASE or to search REBASE for the name of a restriction enzyme, see:
http://rebase.neb.com/rebase/rebase.html
Splitting a Nucleotide Sequence by Specifying an Enzyme
Enter a nucleotide sequence.
Seq = 'AGAGGGGTACGCGCTCTGAAAAGCGGGAACCTCGTGGCGCTTTATTAA';Use the restriction enzyme HspAI (which specifies a recognition sequence of GCGC and a cleavage position of 1) to cleave the nucleotide sequence.
fragmentsEnzyme = restrict(Seq,'HspAI')MATLAB returns:
fragmentsEnzyme =
'AGAGGGGTACG'
'CGCTCTGAAAAGCGGGAACCTCGTGG'
'CGCTTTATTAA'Splitting a Nucleotide Sequence by Specifying a Pattern and Position
Enter a nucleotide sequence.
Seq = 'AGAGGGGTACGCGCTCTGAAAAGCGGGAACCTCGTGGCGCTTTATTAA';Use the sequence pattern GCGC with the point of cleavage at position 3 to cleave the nucleotide sequence.
fragmentsPattern = restrict(Seq,'GCGC',3)MATLAB returns:
fragmentsPattern =
'AGAGGGGTACGCG'
'CTCTGAAAAGCGGGAACCTCGTGGCG'
'CTTTATTAA'Splitting a Nucleotide Sequence by Specifying a Regular Expression for the Pattern
Enter a nucleotide sequence.
Seq = 'AGAGGGGTACGCGCTCTGAAAAGCGGGAACCTCGTGGCGCTTTATTAA';Use a regular expression to specify the sequence pattern.
fragmentsRegExp = restrict(Seq,'GCG[^C]',3)MATLAB returns:
fragmentsRegExp =
'AGAGGGGTACGCGCTCTGAAAAGCG'
'GGAACCTCGTGGCGCTTTATTAA'Returning the Cutting Sites and Fragment Lengths
Enter a nucleotide sequence.
Seq = 'AGAGGGGTACGCGCTCTGAAAAGCGGGAACCTCGTGGCGCTTTATTAA';Capture the cutting sites and fragment lengths as well as the fragments.
[fragments, cut_sites, lengths] = restrict(Seq,'HspAI')MATLAB returns:
fragments =
'AGAGGGGTACG'
'CGCTCTGAAAAGCGGGAACCTCGTGG'
'CGCTTTATTAA'
cut_sites =
0
11
37
lengths =
11
26
11Splitting a Double-Stranded Nucleotide Sequence
Some enzymes specify cutting rules for both a strand and its complement strand. restrict applies the cutting rule only for the 5' —> 3' strand. You can apply this rule manually for the complement strand.
Enter a nucleotide sequence.
seq = 'CCCGCNNNNNNN';
Use the seqcomplement function to determine the complement strand, which is in the 3' —> 5' direction.
seqc = seqcomplement(seq)
MATLAB returns:
seqc = GGGCGNNNNNNN
Cut the first strand using the restriction enzyme FauI (which specifies a recognition sequence pattern of CCCGC and a cleavage position of 9).
cuts_strand1 = restrict(seq, 'FauI')
MATLAB returns:
cuts_strand1 =
'CCCGCNNNN'
'NNN'
Cut the complement strand according the rule specified by FauI (which specifies a recognition sequence pattern of GGGCG with the point of cleavage at position 11).
cuts_strand2 = restrict(seqc, 'GGGCG', 11)
MATLAB returns:
cuts_strand2 =
'GGGCGNNNNNN'
'N'[1] Roberts, R.J., Vincze, T., Posfai, J., and Macelis, D. (2007). REBASE—enzymes and genes for DNA restriction and modification. Nucl. Acids Res. 35, D269–D270.
[2] Official REBASE Web site: http://rebase.neb.com.
cleave | cleavelookup | rebasecuts | regexp | seq2regexp | seqcomplement | seqshowwords

See how to analyze, visualize, and model biological data and systems using MathWorks products.
Get free kit| © 1984-2012- The MathWorks, Inc. - Site Help - Patents - Trademarks - Privacy Policy - Preventing Piracy - RSS |